Mercurial > repos > iuc > snpfreqplot
view heatmap_for_variants.R @ 2:59a7bb93b5fe draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/snpfreqplot/ commit d1c54d077cfc0eeb9699719760e668948cb9bbbc"
| author | iuc |
|---|---|
| date | Fri, 18 Dec 2020 23:47:31 +0000 |
| parents | 480821a403a0 |
| children | eaeb1b3dc23d |
line wrap: on
line source
#!/usr/bin/env R suppressPackageStartupMessages(library(pheatmap)) suppressPackageStartupMessages(library(RColorBrewer)) suppressPackageStartupMessages(library(tidyverse)) fapply <- function(vect_ids, func) { #' List apply but preserve the names res <- lapply(vect_ids, func) names(res) <- vect_ids return(res) } # M A I N stopifnot(exists("samples")) variant_files <- fapply(samples$ids, read_and_process) # nolint extractall_data <- function(id) { variants <- variant_files[[id]] tmp <- variants %>% mutate(unique_selectors = group_select) %>% select(unique_selectors, AF) colnames(tmp) <- c("Mutation", id) return(tmp) } extractall_annots <- function(id) { variants <- variant_files[[id]] tmp <- variants %>% mutate(unique_selectors = group_select, effect = EFF....EFFECT, gene = EFF....GENE) %>% select(unique_selectors, effect, gene) # allow "." as an alternative missing value in EFF.EFFECT and EFF.GENE tmp$effect <- sub("^\\.$", "", tmp$effect) tmp$gene <- sub("^\\.$", "", tmp$gene) return(tmp) } # process allele frequencies processed_files <- fapply(samples$ids, extractall_data) final <- as_tibble( processed_files %>% reduce(full_join, by = "Mutation", copy = T)) final <- final[str_order(final$Mutation, numeric = T), ] %>% column_to_rownames("Mutation") ## sort and set rownames final[final < variant_frequency] <- NA ## adjust the variant frequency: final <- final[rowSums(is.na(final)) != ncol(final), ] final <- t(final) final[is.na(final)] <- 0 class(final) <- "numeric" # add annotations ## readout annotations processed_annots <- fapply(samples$ids, extractall_annots) ann_final <- processed_annots %>% reduce(function(x, y) { unique(rbind(x, y))}) %>% ## apply frequency filter filter(unique_selectors %in% colnames(final)) ann_final <- as_tibble(ann_final[str_order( ann_final$unique_selectors, numeric = T), ]) %>% column_to_rownames("unique_selectors") ## sort # rename annotations trans <- function(x, mapping, replace_missing=NULL) { # helper function for translating effects mapped <- mapping[[x]] if (is.null(mapped)) { if (is.null(replace_missing)) x else replace_missing } else { mapped } } # handle translation of classic SnpEff effects to sequence ontology terms # The following list defines the complete mapping between classic and So effect # terms even if not all of these are likely to appear in viral variant data. classic_snpeff_effects_to_so <- list( "coding_sequence_variant", "coding_sequence_variant", "disruptive_inframe_deletion", "disruptive_inframe_insertion", "inframe_deletion", "inframe_insertion", "downstream_gene_variant", "exon_variant", "exon_loss_variant", "frameshift_variant", "gene_variant", "intergenic_variant", "intergenic_region", "conserved_intergenic_variant", "intragenic_variant", "intron_variant", "conserved_intron_variant", "missense_variant", "rare_amino_acid_variant", "splice_acceptor_variant", "splice_donor_variant", "splice_region_variant", "5_prime_UTR_premature_start_codon_variant", "start_lost", "stop_gained", "stop_lost", "synonymous_variant", "start_retained_variant", "stop_retained_variant", "transcript_variant", "upstream_gene_variant", "3_prime_UTR_truncation_+_exon_loss_variant", "3_prime_UTR_variant", "5_prime_UTR_truncation_+_exon_loss_variant", "5_prime_UTR_variant", "initiator_codon_variant", "None", "chromosomal_deletion" ) names(classic_snpeff_effects_to_so) <- c( "CDS", "CODON_CHANGE", "CODON_CHANGE_PLUS_CODON_DELETION", "CODON_CHANGE_PLUS_CODON_INSERTION", "CODON_DELETION", "CODON_INSERTION", "DOWNSTREAM", "EXON", "EXON_DELETED", "FRAME_SHIFT", "GENE", "INTERGENIC", "INTERGENIC_REGION", "INTERGENIC_CONSERVED", "INTRAGENIC", "INTRON", "INTRON_CONSERVED", "NON_SYNONYMOUS_CODING", "RARE_AMINO_ACID", "SPLICE_SITE_ACCEPTOR", "SPLICE_SITE_DONOR", "SPLICE_SITE_REGION", "START_GAINED", "START_LOST", "STOP_GAINED", "STOP_LOST", "SYNONYMOUS_CODING", "SYNONYMOUS_START", "SYNONYMOUS_STOP", "TRANSCRIPT", "UPSTREAM", "UTR_3_DELETED", "UTR_3_PRIME", "UTR_5_DELETED", "UTR_5_PRIME", "NON_SYNONYMOUS_START", "NONE", "CHROMOSOME_LARGE_DELETION" ) # translate classic effects into SO terms leaving unknown terms (possibly SO already) as is so_effects <- sapply(ann_final$effect, function(x) trans(x, classic_snpeff_effects_to_so)) # handle further translation of effects we care about so_effects_translation <- list( "non-syn", "syn", "deletion", "deletion", "deletion", "insertion", "insertion", "frame shift", "stop gained", "stop lost" ) names(so_effects_translation) <- c( "missense_variant", "synonymous_variant", "disruptive_inframe_deletion", "inframe_deletion", "chromosomal_deletion", "disruptive_inframe_insertion", "inframe_insertion", "frameshift_variant", "stop_gained", "stop_lost" ) # translate to our simple terms turning undefined terms into '?' simple_effects <- sapply(so_effects, function(x) trans(x, so_effects_translation, replace_missing = "?")) # complex variant effects (those that do more than one thing) are concatenated # with either '+' (for classic terms) or '&' (for SO terms) simple_effects[grepl("+", so_effects, fixed = TRUE)] <- "complex" simple_effects[grepl("&", so_effects, fixed = TRUE)] <- "complex" simple_effects[so_effects == ""] <- "non-coding" ann_final$effect <- simple_effects ann_final$gene <- sub("^$", "NCR", ann_final$gene) ## automatically determine gaps for the heatmap gap_vector <- which(!(ann_final$gene[1:length(ann_final$gene) - 1] == # nolint ann_final$gene[2:length(ann_final$gene)])) # colormanagement my_colors <- colorRampPalette(c("grey93", "brown", "black")) #heatmap count <- length(unique(ann_final$gene)) #annotations (genes) gene_color <- rep(c(brewer.pal(brewer_color_gene_annotation, n = count)), length.out = count) names(gene_color) <- unique(ann_final$gene) # colormanagement annotations (effect) ## Define the full set of colors for each effect that we can encounter ## This is not bulletproof. The effect names given here were swapped into the ## data (see above substitutions in ann_final$effect) and so are hard-coded, ## as well as their preferred colors. all_colors <- data.frame( color = c("white", "green", "orange", "red", "black", "grey", "yellow", "blue", "purple", "brown"), name = c("non-coding", "syn", "non-syn", "deletion", "frame shift", "stop gained", "stop lost", "insertion", "complex", "?")) ## Reduce the full set to just those that we want detected_effects <- unique(ann_final$effect) subset_colors <- subset(all_colors, name %in% detected_effects) effect_color <- subset_colors$color names(effect_color) <- subset_colors$name color_list <- list(gene_color = gene_color, effect_color = effect_color) names(color_list) <- c("gene", "effect") # visualize heatmap if (pheat_number_of_clusters > length(samples$ids)) { print(paste0("[INFO] Number of clusters: User-specified clusters (", pheat_number_of_clusters, ") is greater than the number of samples (", length(samples$ids), ")")) pheat_number_of_clusters <- length(samples$ids) print(paste0("[INFO] Number of clusters: now set to ", pheat_number_of_clusters)) } # Fix Labels ## Prettify names, check for label parity between final and ann_final fix_label <- function(name) { ##' Reduce: 424 AGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTT A ##' to: 424 AGT… > A cols <- unlist(str_split(name, " ")) ## first 3 are POS REF ALT, and the rest are optional differences pos_ref_alt <- cols[1:3] rest <- "" if (length(cols) > 3) { rest <- paste0(" :: ", paste0(cols[4:length(cols)], collapse = " ")) } ## Trim the REF or ALT if too long if (str_length(pos_ref_alt[2]) > 3) { pos_ref_alt[2] <- paste0(substring(pos_ref_alt[2], 1, 3), "…") } if (str_length(pos_ref_alt[3]) > 3) { pos_ref_alt[3] <- paste0(substring(pos_ref_alt[3], 1, 3), "…") } ## Join required new_name <- paste0(pos_ref_alt[1], " ", pos_ref_alt[2], " > ", pos_ref_alt[3]) ## Join rest new_name <- paste0(new_name, " ", rest) } colnames(final) <- sapply(colnames(final), fix_label) rownames(ann_final) <- sapply(rownames(ann_final), fix_label) ## sanity test stopifnot(all(colnames(final) %in% rownames(ann_final))) # Perform Plotting get_plot_dims <- function(heat_map) { ## get the dimensions of a pheatmap object ## useful for plot formats that can't be written to a file directly, but ## for which we need to set up a plotting device ## source: https://stackoverflow.com/a/61876386 plot_height <- sum(sapply(heat_map$gtable$heights, grid::convertHeight, "in")) plot_width <- sum(sapply(heat_map$gtable$widths, grid::convertWidth, "in")) return(list(height = plot_height, width = plot_width)) } height <- round(max(c(max(c( 16 * (length(unique(ann_final$effect)) + length(unique(ann_final$gene))), 160)) / nrow(final), 15))) width <- round(ratio * height) if (!(out_ext %in% c("svg", "jpeg", "png", "pdf"))) { stop("Unknown extension: ", ext, ", aborting.") } plot_device <- get(out_ext) ## A constant scaling factor based on the calculated dimensions ## above does not work for PNG, so we resort to feeding pheatmap ## with a direct filename plot_filename <- NA if (out_ext %in% c("jpeg", "png")) { plot_filename <- out_file } ## SVG is not a format pheatmap knows how to write to a file directly. ## As a workaround we ## 1. create the plot object ## 2. get its dimensions ## 3. set up a svg plotting device with these dimensions ## 4. print the heatmap object to the device hm <- pheatmap( final, color = my_colors(100), cellwidth = width, cellheight = height, fontsize_col = round(1 / 3 * width), fontsize_row = round(1 / 3 * min(c(height, width))), clustering_method = pheat_clustering_method, cluster_rows = pheat_clustering, cluster_cols = F, cutree_rows = pheat_number_of_clusters, annotation_col = ann_final, annotation_colors = color_list, filename = plot_filename, gaps_col = gap_vector ) if (out_ext %in% c("pdf", "svg")) { plot_dims <- get_plot_dims(hm) plot_device(out_file, width = plot_dims$width, height = plot_dims$height) print(hm) dev.off() }
