Mercurial > repos > iuc > remove_terminal_stop_codons
view test-data/with_terminal_stop.fasta @ 0:91bda876f648 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/remove_terminal_stop_codons commit 0c1c0e260ebecab6beb23fd56322b391e62d12fa
| author | iuc |
|---|---|
| date | Fri, 05 Dec 2025 23:22:22 +0000 |
| parents | |
| children |
line wrap: on
line source
>seq1 test sequence with terminal TAA stop ATGAAACCCGGGTAA >seq2 test sequence with terminal TAG stop ATGCCCAAAGGGCCCAAATAG >seq3 test sequence with terminal TGA stop ATGGGGTTTAAACCCGGGTGA
