# HG changeset patch # User iuc # Date 1761840201 0 # Node ID aaf7754dafd3cb5b61636a8c5ec233a775a17d43 # Parent 0d63988e23c30a60718b17225b0ad78ab1afa71b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/obitools commit a01e3c562cf5d62af522b893a25abde6476a1f45 diff -r 0d63988e23c3 -r aaf7754dafd3 illuminapairedend.xml.orig --- a/illuminapairedend.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,169 +0,0 @@ -<<<<<<< HEAD - - Construct consensus reads from Illumina pair-end reads - - macros.xml - - - - - fastq3p.fastq && - gunzip -c '$inputfastq5p' > fastq5p.fastq && - #else - ln -s '$inputfastq3p' fastq3p.fastq && - ln -s '$inputfastq5p' fastq5p.fastq && - #end if - - illuminapairedend - ##--index-file= - #if $inputfastq3p.ext.startswith("fastqsolexa") - ##input file is in fastq nucleic format produced by solexa sequencer - --solexa - #else if $inputfastq3p.ext.startswith("fastqillumina") - ##input file is in fastq nucleic format produced by solexa sequencer - --illumina - #else - ## input file is in sanger fastq nucleic format (standard fastq) - --sanger - #end if - --without-progress-bar - --score-min='$score' - -r fastq3p.fastq - fastq5p.fastq - #if $inputfastq3p.ext.endswith(".gz") - | gzip -c - #end if - > '$output' - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -======= - - Construct consensus reads from Illumina pair-end reads - - - macros.xml - - - - - - '$output' - - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - ->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 macros.xml.orig --- a/macros.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,248 +0,0 @@ - - - - - obitools - - -<<<<<<< HEAD - - 1.2.13 - 21.01 -======= - - - obitools - - - 1.2.11 ->>>>>>> 7abad681f (add tools up until P) - - - - - - - - fastqsanger,fastqsanger.gz,fastqsolexa,fastqsolexa.gz,fasta,fasta.gz - input && - #else - ln -s '$input' input && - #end if - ]]> - - - - > galaxy.json - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
- - - - - - - - - - - - - - -
-
- - - - - - - - - - - - - - - - - - 10.1111/1755-0998.12428 - - - -
diff -r 0d63988e23c3 -r aaf7754dafd3 ngsfilter.xml.orig --- a/ngsfilter.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,239 +0,0 @@ -<<<<<<< HEAD - - Assigns sequence records to the corresponding experiment/sample based on DNA tags and primers - - macros.xml - - - - '$output' - - #if $bool - #if $input.ext.endswith(".gz") - && gzip -c unident > '$unident' - #else - && mv unident '$unident' - #end if - #set outputs = [("output", $output), ("unident", $unident)] - #end if - @GENERATE_GALAXY_JSON@ - ]]> - - - - - - - - - - - bool is True - - - - - - - - - - - - - - - - - - - - - - - - - - -======= - - Assigns sequence records to the corresponding experiment/sample based on DNA tags and primers - - - macros.xml - - - - - '$output' - - ]]> - - - - - - - - - - - - bool is True - - - - - - - - - - - - - - - - - - - - - - - - - - ->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 obiannotate.xml.orig --- a/obiannotate.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,337 +0,0 @@ -<<<<<<< HEAD - - Adds/Edits sequence record annotations - - macros.xml - - - - '$output' - - @GENERATE_GALAXY_JSON@ - ]]> - - - - -
- - -
- - -
- - -
- - - - - - - - - - - - - -
- - - - - -
- - - - - - - - - - -
- - - - - - -
- - -
- - - - - - -
- - -
- - -
- - - - - -
- -
- - - - - -
-======= - - Adds/Edits sequence record annotations - - - macros.xml - - - - - - '$output' - ]]> - - - - - - -
- - -
- - -
- - -
- - - - - - - - - - - - - -
- - - - - -
- - - - - - - - - -
- - - - - - - -
- - -
- - - - - - -
-
- - - - - -
->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 obiclean.xml.orig --- a/obiclean.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,156 +0,0 @@ -<<<<<<< HEAD - - tags a set of sequences for PCR/sequencing errors identification - - macros.xml - - - - - '$output' - @GENERATE_GALAXY_JSON@ - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -======= - - tags a set of sequences for PCR/sequencing errors identification - - - macros.xml - - - - - - - '$output' - - - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 obiconvert.xml.orig --- a/obiconvert.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,215 +0,0 @@ -<<<<<<< HEAD - - converts sequence files to different output formats - - macros.xml - - - - '${output}' - @GENERATE_GALAXY_JSON@ - ]]> - - - - - - - - - - - - ecopcrdb == True - - - - - - - - - - - - - - - - - - - -======= - - converts sequence files to different output formats - - - macros.xml - - - - - - '${output}' - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - ecopcrdb == True - - - - - - - - - - - - - - - - - - - - - - - ->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 obigrep.xml.orig --- a/obigrep.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,337 +0,0 @@ -<<<<<<< HEAD - - Filters sequence file - - macros.xml - - - - '$output' - @GENERATE_GALAXY_JSON@ - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -======= - - Filters sequence file - - - macros.xml - - - - - - - '$output' - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 obisort.xml --- a/obisort.xml Wed Sep 01 07:53:40 2021 +0000 +++ b/obisort.xml Thu Oct 30 16:03:21 2025 +0000 @@ -1,9 +1,9 @@ sorts sequence records according to the value of a given attribute - macros.xml + @@ -11,7 +11,9 @@ @GUNZIP_INPUT@ obisort --without-progress-bar + #if $key: -k '$key' + #end if ${reverse} @INPUT_FORMAT@ @OUT_FORMAT@ @@ -21,9 +23,14 @@ @GENERATE_GALAXY_JSON@ ]]> - - - + + + @@ -31,14 +38,14 @@ - + - + @@ -56,8 +63,29 @@ @OBITOOLS_LINK@ - ]]> +**Inputs:** + +For sorting by key, the input file must be in the +`OBITools FASTA/FASTQ format `_. +If your file is an OBITools output, it should already be formatted correctly. + +For FASTA files, your headers should look like this:: + >my_sequence taxid=3456; direct=True; sample=A354; this is my pretty sequence + ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT + GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT + AACGACGTTGCAGTACGTTGCAGT + +Where ``taxid``, ``direct``, and ``sample`` are keys that can be used for sorting. + +If your sequences don't have title, you can format the headers with a trailing semicolon like so:: + + >my_sequence key1=value1; + +For sorting OBITools output files, a list of OBITools sequence attributes are documented +`here `_. + +]]> diff -r 0d63988e23c3 -r aaf7754dafd3 obisort.xml.orig --- a/obisort.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,133 +0,0 @@ -<<<<<<< HEAD - - sorts sequence records according to the value of a given attribute - - macros.xml - - - - - '$output' - @GENERATE_GALAXY_JSON@ - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -======= - - sorts sequence records according to the value of a given attribute, which can be either numeric or alphanumeric - - - macros.xml - - - - - - - '$output' - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 obistat.xml.orig --- a/obistat.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,288 +0,0 @@ -<<<<<<< HEAD - - computes basic statistics for attribute values - - macros.xml - - - - '$output' - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -======= - - computes basic statistics for attribute values - - - macros.xml - - - - - - - '$output' - - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 obitab.xml.orig --- a/obitab.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,123 +0,0 @@ -<<<<<<< HEAD - - converts sequence file to a tabular file - - macros.xml - - - - '$output' - ]]> - - - - - - - - - - - - - - - - - - - - - - -======= - - converts sequence file to a tabular file that can be open by a spreadsheet program or R - - - macros.xml - - - - - - - '$output' - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 obiuniq.xml.orig --- a/obiuniq.xml.orig Wed Sep 01 07:53:40 2021 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,182 +0,0 @@ -<<<<<<< HEAD - - - macros.xml - - - - '$output' - @GENERATE_GALAXY_JSON@ - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -======= - - - - macros.xml - - - - - - '$output' - - ]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ->>>>>>> 7abad681f (add tools up until P) diff -r 0d63988e23c3 -r aaf7754dafd3 test-data/input_ngsfilter_extrafile.txt --- a/test-data/input_ngsfilter_extrafile.txt Wed Sep 01 07:53:40 2021 +0000 +++ b/test-data/input_ngsfilter_extrafile.txt Thu Oct 30 16:03:21 2025 +0000 @@ -1,4 +1,4 @@ -wolf_diet 13a_F730603 aattaac TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F @ -wolf_diet 15a_F730814 gaagtag TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F @ -wolf_diet 26a_F040644 gaatatc TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F @ -wolf_diet 29a_F260619 gcctcct TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F @ +wolf_diet 13a_F730603 aattaac TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F @ +wolf_diet 15a_F730814 gaagtag TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F @ +wolf_diet 26a_F040644 gaatatc TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F @ +wolf_diet 29a_F260619 gcctcct TTAGATACCCCACTATGC TAGAACAGGCTCCTCTAG F @