diff test-data/porechop.log @ 27:b7e8663db1ec draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/multiqc commit 327834d2ea9b16f0f0264fa4e9b675a2277f2fee
author iuc
date Tue, 18 Feb 2025 23:17:45 +0000
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/porechop.log	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,153 @@
+
+Loading reads
+/tmp/tmp4zxnky4h/files/5/c/1/dataset_5c125cad-e633-41bc-8f37-36d6af3f5f0f.dat
+9 reads loaded
+
+
+Looking for known adapter sets
+
0 / 9 (0.0%)
9 / 9 (100.0%)
9 / 9 (100.0%)
+                                        Best               
+                                        read       Best    
+                                        start      read end
+  Set                                   %ID        %ID     
+  SQK-NSK007                                96.4       95.5
+  Rapid                                     62.5        0.0
+  RBK004_upstream                           72.7        0.0
+  SQK-MAP006                                62.2       63.6
+  SQK-MAP006 short                          60.7       60.0
+  PCR adapters 1                            66.7       73.9
+  PCR adapters 2                            66.7       63.6
+  PCR adapters 3                            68.0       72.0
+  1D^2 part 1                               62.1       58.8
+  1D^2 part 2                               79.4       68.8
+  cDNA SSP                                  57.1       61.4
+  Barcode 1 (reverse)                       59.4       66.7
+  Barcode 2 (reverse)                       66.7       63.0
+  Barcode 3 (reverse)                       69.2       72.0
+  Barcode 4 (reverse)                       66.7       63.3
+  Barcode 5 (reverse)                       62.5       66.7
+  Barcode 6 (reverse)                       73.1       62.5
+  Barcode 7 (reverse)                       65.4       65.5
+  Barcode 8 (reverse)                       69.2       58.3
+  Barcode 9 (reverse)                       75.0       66.7
+  Barcode 10 (reverse)                      62.5       60.0
+  Barcode 11 (reverse)                      69.2       60.5
+  Barcode 12 (reverse)                      65.6       64.0
+  Barcode 1 (forward)                       65.4       61.5
+  Barcode 2 (forward)                       69.2       70.4
+  Barcode 3 (forward)                       73.1       68.0
+  Barcode 4 (forward)                       73.1       64.3
+  Barcode 5 (forward)                       62.5       66.7
+  Barcode 6 (forward)                       65.5       65.6
+  Barcode 7 (forward)                       73.1       66.7
+  Barcode 8 (forward)                       62.1       60.7
+  Barcode 9 (forward)                       68.0       70.8
+  Barcode 10 (forward)                      69.2       66.7
+  Barcode 11 (forward)                      65.4       60.7
+  Barcode 12 (forward)                      64.3       66.7
+  Barcode 13 (forward)                      64.3       69.2
+  Barcode 14 (forward)                      63.3       66.7
+  Barcode 15 (forward)                      66.7       66.7
+  Barcode 16 (forward)                      70.8       65.5
+  Barcode 17 (forward)                      69.2       66.7
+  Barcode 18 (forward)                      70.4       70.4
+  Barcode 19 (forward)                      65.5       64.0
+  Barcode 20 (forward)                      65.5       64.0
+  Barcode 21 (forward)                      64.3       66.7
+  Barcode 22 (forward)                      69.2       68.0
+  Barcode 23 (forward)                      61.5       66.7
+  Barcode 24 (forward)                      66.7       65.4
+  Barcode 25 (forward)                      64.0       65.5
+  Barcode 26 (forward)                      72.0       72.0
+  Barcode 27 (forward)                      77.8       60.7
+  Barcode 28 (forward)                      65.5       66.7
+  Barcode 29 (forward)                      62.5       66.7
+  Barcode 30 (forward)                      68.0       65.4
+  Barcode 31 (forward)                      62.5       69.2
+  Barcode 32 (forward)                      68.0       70.8
+  Barcode 33 (forward)                      62.5       70.4
+  Barcode 34 (forward)                      64.0       62.5
+  Barcode 35 (forward)                      65.5       65.4
+  Barcode 36 (forward)                      63.0       63.0
+  Barcode 37 (forward)                      67.9       64.3
+  Barcode 38 (forward)                      64.0       62.1
+  Barcode 39 (forward)                      64.0       69.2
+  Barcode 40 (forward)                      62.5       64.0
+  Barcode 41 (forward)                      68.0       65.5
+  Barcode 42 (forward)                      70.4       69.2
+  Barcode 43 (forward)                      63.3       63.3
+  Barcode 44 (forward)                      60.0       66.7
+  Barcode 45 (forward)                      73.1       65.4
+  Barcode 46 (forward)                      65.4       60.7
+  Barcode 47 (forward)                      65.5       64.0
+  Barcode 48 (forward)                      71.4       62.1
+  Barcode 49 (forward)                      69.2       62.1
+  Barcode 50 (forward)                      66.7       63.0
+  Barcode 51 (forward)                      69.2       64.3
+  Barcode 52 (forward)                      66.7       64.0
+  Barcode 53 (forward)                      67.9       69.0
+  Barcode 54 (forward)                      69.2       64.0
+  Barcode 55 (forward)                      66.7       73.1
+  Barcode 56 (forward)                      66.7       72.0
+  Barcode 57 (forward)                      69.0       60.0
+  Barcode 58 (forward)                      70.4       72.0
+  Barcode 59 (forward)                      56.7       66.7
+  Barcode 60 (forward)                      66.7       66.7
+  Barcode 61 (forward)                      70.8       65.5
+  Barcode 62 (forward)                      66.7       68.0
+  Barcode 63 (forward)                      66.7       60.7
+  Barcode 64 (forward)                      69.2       66.7
+  Barcode 65 (forward)                      61.5       69.0
+  Barcode 66 (forward)                      64.3       63.0
+  Barcode 67 (forward)                      66.7       67.9
+  Barcode 68 (forward)                      67.9       69.2
+  Barcode 69 (forward)                      69.2       75.0
+  Barcode 70 (forward)                      64.3       73.1
+  Barcode 71 (forward)                      64.0       71.4
+  Barcode 72 (forward)                      66.7       62.1
+  Barcode 73 (forward)                      67.7       64.0
+  Barcode 74 (forward)                      64.5       68.0
+  Barcode 75 (forward)                      65.4       65.5
+  Barcode 76 (forward)                      70.4       70.8
+  Barcode 77 (forward)                      65.4       64.3
+  Barcode 78 (forward)                      67.7       63.0
+  Barcode 79 (forward)                      70.8       69.2
+  Barcode 80 (forward)                      71.4       72.0
+  Barcode 81 (forward)                      68.0       66.7
+  Barcode 82 (forward)                      64.7       66.7
+  Barcode 83 (forward)                      69.2       68.0
+  Barcode 84 (forward)                      70.8       67.9
+  Barcode 85 (forward)                      61.5       60.0
+  Barcode 86 (forward)                      64.3       65.4
+  Barcode 87 (forward)                      66.7       65.4
+  Barcode 88 (forward)                      63.3       60.7
+  Barcode 89 (forward)                      69.2       66.7
+  Barcode 90 (forward)                      66.7       64.0
+  Barcode 91 (forward)                      68.0       64.3
+  Barcode 92 (forward)                      65.5       68.0
+  Barcode 93 (forward)                      69.2       73.1
+  Barcode 94 (forward)                      63.0       68.0
+  Barcode 95 (forward)                      64.0       63.3
+  Barcode 96 (forward)                      69.0       68.0
+
+
+Trimming adapters from read ends
+     SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT
+  SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT
+
+
0 / 9 (0.0%)
9 / 9 (100.0%)
9 / 9 (100.0%)
+
+4 / 9 reads had adapters trimmed from their start (74 bp removed)
+3 / 9 reads had adapters trimmed from their end (49 bp removed)
+
+
+Splitting reads containing middle adapters
+
0 / 9 (0.0%)
9 / 9 (100.0%)
10 / 9 (111.1%)
9 / 9 (100.0%)
+
+4 / 9 reads were split based on middle adapters
+
+
+Saving trimmed reads to file
+
+Saved result to /tmp/tmp4zxnky4h/job_working_directory/000/2/working/out.fasta
+