annotate test-data/sample3.fa @ 2:a92e6daa48d6 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit e2075caee2ecdc6aed15a356e5328c5ca09cfb13
author iuc
date Thu, 08 Jun 2017 15:31:39 -0400
parents b32ea8b26bda
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
b32ea8b26bda planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
1 > seq1 This is the description of my first sequence in sample 3.
b32ea8b26bda planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
2 AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
b32ea8b26bda planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
3 > seq2 This is a description of my second sequence in sample 3.
b32ea8b26bda planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
4 CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG
b32ea8b26bda planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
5 > seq3 This is a description of my third sequence in sample 3.
b32ea8b26bda planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
6 CGATCGATCGTACGTCGACTAGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGCGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG