Mercurial > repos > iuc > mothur_summary_single
annotate test-data/sample2.fa @ 2:a92e6daa48d6 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit e2075caee2ecdc6aed15a356e5328c5ca09cfb13
| author | iuc |
|---|---|
| date | Thu, 08 Jun 2017 15:31:39 -0400 |
| parents | b32ea8b26bda |
| children |
| rev | line source |
|---|---|
|
0
b32ea8b26bda
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff
changeset
|
1 > seq1 This is the description of my first and only sequence in sample 2. |
|
b32ea8b26bda
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff
changeset
|
2 AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC |
