Mercurial > repos > iuc > mothur_remove_rare

view test-data/sample2.fa @ 10:1b72a2a359df draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 10343a75a64aa221f52f1862b0a735701c867c68"
author iuc
date Sun, 01 Dec 2019 01:16:38 +0000
parents e3e42e0b45a3
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC