annotate test-data/sample3.fa @ 5:ddd8e4aecd6c draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 283d5933cd945b7815b3da2ce45baa60d73e9746
author iuc
date Fri, 06 Apr 2018 03:31:48 -0400
parents 1e33b551033e
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
1e33b551033e planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
1 > seq1 This is the description of my first sequence in sample 3.
1e33b551033e planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
2 AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
1e33b551033e planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
3 > seq2 This is a description of my second sequence in sample 3.
1e33b551033e planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
4 CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG
1e33b551033e planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
5 > seq3 This is a description of my third sequence in sample 3.
1e33b551033e planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
iuc
parents:
diff changeset
6 CGATCGATCGTACGTCGACTAGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGCGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG