Mercurial > repos > iuc > mothur_merge_count
diff test-data/sample1.fa @ 0:41c7989dd5e6 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 4648c7574a78601e03ae6a318cbcd5b492a8a9f4
| author | iuc |
|---|---|
| date | Wed, 14 Feb 2018 10:34:48 -0500 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.fa Wed Feb 14 10:34:48 2018 -0500 @@ -0,0 +1,4 @@ +> seq1 This is the description of my first sequence in sample 1. +AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC +> seq2 This is a description of my second sequence in sample 1. +CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG
