Mercurial > repos > iuc > mothur_make_group

view test-data/sample2.fa @ 6:06ddf1f9ffd4 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit be5c8af076296a53959fc3ed2b82d92dc7607eeb
author iuc
date Mon, 23 Apr 2018 09:01:45 -0400
parents 1cf5a6a5eb05
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC