Mercurial > repos > iuc > mothur_make_group

diff test-data/sample1.fa @ 0:1cf5a6a5eb05 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit ea40e3d84e7850eb4226d6c85f709dcad18d4ba9
author iuc
date Thu, 18 May 2017 18:14:05 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample1.fa	Thu May 18 18:14:05 2017 -0400
@@ -0,0 +1,4 @@
+> seq1 This is the description of my first sequence in sample 1.
+AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
+> seq2 This is a description of my second sequence in sample 1.
+CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG