diff test-data/sample1.fa @ 0:d20133cb8909 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
author iuc
date Fri, 24 Jun 2016 16:39:36 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample1.fa	Fri Jun 24 16:39:36 2016 -0400
@@ -0,0 +1,4 @@
+> seq1 This is the description of my first sequence in sample 1.
+AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
+> seq2 This is a description of my second sequence in sample 1.
+CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG