Mercurial > repos > iuc > mothur_get_oturep

view test-data/sample2.fa @ 5:2ac0e471b97a draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 38a2bbee32eaaceeb22d7549b13dbc0c613ee173
author iuc
date Tue, 20 Mar 2018 13:55:52 -0400
parents d568050a95be
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC