Mercurial > repos > iuc > mothur_deunique_tree

view test-data/sample2.fa @ 5:24635ce930ee draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 38a2bbee32eaaceeb22d7549b13dbc0c613ee173
author iuc
date Tue, 20 Mar 2018 13:53:25 -0400
parents 049d12e3c803
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC