Mercurial > repos > iuc > mothur_count_seqs
diff test-data/sample1.fa @ 0:be91d6962b0c draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 180a403421967d36f995941b1a4561349d75cfc5
| author | iuc |
|---|---|
| date | Fri, 24 Jun 2016 16:28:37 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.fa Fri Jun 24 16:28:37 2016 -0400 @@ -0,0 +1,4 @@ +> seq1 This is the description of my first sequence in sample 1. +AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC +> seq2 This is a description of my second sequence in sample 1. +CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG
