Mercurial > repos > iuc > mothur_collect_shared

view test-data/sample2.fa @ 3:c46d135d6a32 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 4648c7574a78601e03ae6a318cbcd5b492a8a9f4
author iuc
date Wed, 14 Feb 2018 10:12:35 -0500
parents e9f8b81fa72c
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC