Mercurial > repos > iuc > mothur_cluster_split

view test-data/sample2.fa @ 5:f14e393f1641 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 38a2bbee32eaaceeb22d7549b13dbc0c613ee173
author iuc
date Tue, 20 Mar 2018 14:04:03 -0400
parents e56e12d98ac4
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC