Mercurial > repos > iuc > mothur_classify_svm

diff test-data/sample1.fa @ 0:ba0b90285bc0 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 4648c7574a78601e03ae6a318cbcd5b492a8a9f4
author iuc
date Wed, 14 Feb 2018 10:29:38 -0500
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample1.fa	Wed Feb 14 10:29:38 2018 -0500
@@ -0,0 +1,4 @@
+> seq1 This is the description of my first sequence in sample 1.
+AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
+> seq2 This is a description of my second sequence in sample 1.
+CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG