Mercurial > repos > iuc > mothur_classify_seqs

view test-data/sample2.fa @ 3:af9313bec520 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 2d63134651d49a0dc962d5b7a1b544bcc092fdf2
author iuc
date Wed, 13 Sep 2017 15:41:56 -0400
parents 0b58880da760
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC