Mercurial > repos > iuc > mothur_bin_seqs

view test-data/sample2.fa @ 3:cb91c12c8a34 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit ca8dc573528ab7c5290bc6ca029cb989f4755db6
author iuc
date Fri, 08 Sep 2017 12:47:07 -0400
parents c9045fb0bf49
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC