# HG changeset patch # User iuc # Date 1450694738 18000 # Node ID 16752a2d49c49c7c46439eef02ef42c8b53d1051 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/meme commit 71ac7e12419b8541746ebf8d4ba704cbbd603db1 diff -r 000000000000 -r 16752a2d49c4 meme.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/meme.xml Mon Dec 21 05:45:38 2015 -0500 @@ -0,0 +1,333 @@ + + - Multiple Em for Motif Elicitation + + meme + + + &1 || echo "Error running MEME." + && mv ${html_outfile.files_path}/meme.html ${html_outfile} + && mv ${html_outfile.files_path}/meme.txt ${txt_outfile} + && mv ${html_outfile.files_path}/meme.xml ${xml_outfile} + ]]> + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + value == True + + + + + + + + + + + + + + + + + + + + + + + + + + + + +.. class:: warningmark + +**WARNING: This tool is only available for non-commercial use. Use for educational, research and non-profit purposes is permitted. +Before using, be sure to review, agree, and comply with the license.** + +If you want to specify sequence weights, you must include them at the top of your input FASTA file. + +MEME discovers novel, ungapped motifs (recurring, fixed-length patterns) in your sequences (sample output from sequences). +MEME splits variable-length patterns into two or more separate motifs. A motif is a sequence pattern that occurs repeatedly +in a group of related sequences. MEME represents motifs as position-dependent letter-probability matrices which describe the +probability of each possible letter at each position in the pattern. Individual MEME motifs do not contain gaps. Patterns +with variable-length gaps are split by MEME into two or more separate motifs. MEME takes as input a group of sequences and +outputs as many motifs as requested. MEME uses statistical modeling techniques to automatically choose the best width, number +of occurrences, and description for each motif. + +.. class:: infomark + +For detailed information on MEME, click here_, or view the license_. + +.. _here: http://meme-suite.org/doc/meme.html?man_type=web +.. _license: http://meme-suite.org/doc/copyright.html?man_type=web + + + + + @published{Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, + author = {Bailey,Timothy L. and Elkan, Charles}, + title = {Fitting a mixture model by expectation maximization to discover motifs in biopolymers}, + year = {1994}, + eprint = {None}, + url = {http://www.sdsc.edu/~tbailey/papers/ismb94.pdf} + } + + diff -r 000000000000 -r 16752a2d49c4 test-data/meme_input_1.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme_input_1.fasta Mon Dec 21 05:45:38 2015 -0500 @@ -0,0 +1,66 @@ +>chr21_19617074_19617124_+ +AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA +>chr21_26934381_26934431_+ +GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT +>chr21_28217753_28217803_- +CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA +>chr21_31710037_31710087_- +AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT +>chr21_31744582_31744632_- +CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA +>chr21_31768316_31768366_+ +AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT +>chr21_31914206_31914256_- +TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC +>chr21_31933633_31933683_- +TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT +>chr21_31962741_31962791_- +ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA +>chr21_31964683_31964733_+ +TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC +>chr21_31973364_31973414_+ +aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC +>chr21_31992870_31992920_+ +CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT +>chr21_32185595_32185645_- +TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA +>chr21_32202076_32202126_- +TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT +>chr21_32253899_32253949_- +AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC +>chr21_32410820_32410870_- +TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG +>chr21_36411748_36411798_- +ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt +>chr21_37838750_37838800_- +gatggttttataaggggcctcaccctcggctcagccctcattcttctcct +>chr21_45705687_45705737_+ +CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC +>chr21_45971413_45971463_- +CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca +>chr21_45978668_45978718_- +CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca +>chr21_45993530_45993580_+ +CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC +>chr21_46020421_46020471_+ +GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc +>chr21_46031920_46031970_+ +GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC +>chr21_46046964_46047014_+ +ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca +>chr21_46057197_46057247_+ +ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC +>chr21_46086869_46086919_- +GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC +>chr21_46102103_46102153_- +AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG diff -r 000000000000 -r 16752a2d49c4 test-data/meme_output_html_1.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme_output_html_1.html Mon Dec 21 05:45:38 2015 -0500 @@ -0,0 +1,100 @@ + + + + + MEME +