# HG changeset patch # User iuc # Date 1468155710 14400 # Node ID de3c73f5845185ef014a68129464c3cb0789c288 # Parent 3357222bd84327c2678d1e434ba7e87f0bd7b611 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/meme commit ef11594cf3ca79e444ab4e30d83de5951a636faf diff -r 3357222bd843 -r de3c73f58451 fimo.xml --- a/fimo.xml Thu Jul 07 09:53:04 2016 -0400 +++ b/fimo.xml Sun Jul 10 09:01:50 2016 -0400 @@ -1,9 +1,16 @@ - + - Scan a set of sequences for motifs. - imagemagick - meme + graphicsmagick + meme + + + + + + + - + diff -r 3357222bd843 -r de3c73f58451 test-data/fimo_output_html_1.html --- a/test-data/fimo_output_html_1.html Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/fimo_output_html_1.html Sun Jul 10 09:01:50 2016 -0400 @@ -25,7 +25,7 @@
FIMO - Motif search tool

-FIMO version 4.11.0, (Release date: Thu Nov 26 17:48:49 2015 +1000) +FIMO version 4.11.1, (Release date: Fri Jan 15 12:51:59 2016 -0800)

For further information on how to interpret these results diff -r 3357222bd843 -r de3c73f58451 test-data/fimo_output_html_2.html --- a/test-data/fimo_output_html_2.html Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/fimo_output_html_2.html Sun Jul 10 09:01:50 2016 -0400 @@ -25,7 +25,7 @@

FIMO - Motif search tool

-FIMO version 4.11.0, (Release date: Thu Nov 26 17:48:49 2015 +1000) +FIMO version 4.11.1, (Release date: Fri Jan 15 12:51:59 2016 -0800)

For further information on how to interpret these results diff -r 3357222bd843 -r de3c73f58451 test-data/fimo_output_xml_1.xml --- a/test-data/fimo_output_xml_1.xml Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/fimo_output_xml_1.xml Sun Jul 10 09:01:50 2016 -0400 @@ -1,6 +1,6 @@ - + xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation= xmlns:fimo="http://noble.gs.washington.edu/schema/fimo" > diff -r 3357222bd843 -r de3c73f58451 test-data/fimo_output_xml_2.xml --- a/test-data/fimo_output_xml_2.xml Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/fimo_output_xml_2.xml Sun Jul 10 09:01:50 2016 -0400 @@ -1,6 +1,6 @@ - + xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation= xmlns:fimo="http://noble.gs.washington.edu/schema/fimo" > diff -r 3357222bd843 -r de3c73f58451 test-data/meme_input_1.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme_input_1.fasta Sun Jul 10 09:01:50 2016 -0400 @@ -0,0 +1,66 @@ +>chr21_19617074_19617124_+ +AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA +>chr21_26934381_26934431_+ +GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT +>chr21_28217753_28217803_- +CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA +>chr21_31710037_31710087_- +AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT +>chr21_31744582_31744632_- +CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA +>chr21_31768316_31768366_+ +AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT +>chr21_31914206_31914256_- +TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC +>chr21_31933633_31933683_- +TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT +>chr21_31962741_31962791_- +ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA +>chr21_31964683_31964733_+ +TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC +>chr21_31973364_31973414_+ +aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC +>chr21_31992870_31992920_+ +CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT +>chr21_32185595_32185645_- +TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA +>chr21_32202076_32202126_- +TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT +>chr21_32253899_32253949_- +AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC +>chr21_32410820_32410870_- +TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG +>chr21_36411748_36411798_- +ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt +>chr21_37838750_37838800_- +gatggttttataaggggcctcaccctcggctcagccctcattcttctcct +>chr21_45705687_45705737_+ +CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC +>chr21_45971413_45971463_- +CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca +>chr21_45978668_45978718_- +CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca +>chr21_45993530_45993580_+ +CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC +>chr21_46020421_46020471_+ +GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc +>chr21_46031920_46031970_+ +GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC +>chr21_46046964_46047014_+ +ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca +>chr21_46057197_46057247_+ +ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC +>chr21_46086869_46086919_- +GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC +>chr21_46102103_46102153_- +AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG diff -r 3357222bd843 -r de3c73f58451 test-data/meme_output_html_1.html --- a/test-data/meme_output_html_1.html Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/meme_output_html_1.html Sun Jul 10 09:01:50 2016 -0400 @@ -7,8 +7,8 @@ // @JSON_VAR data var data = { "program": "MEME", - "version": "4.11.0", - "release": "Thu Nov 26 17:48:49 2015 +1000", + "version": "4.11.1", + "release": "Fri Jan 15 12:51:59 2016 -0800", "stop_reason": "Stopped because requested number of motifs (1) found.", "cmd": [ "meme", diff -r 3357222bd843 -r de3c73f58451 test-data/meme_output_html_2.html --- a/test-data/meme_output_html_2.html Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/meme_output_html_2.html Sun Jul 10 09:01:50 2016 -0400 @@ -7,8 +7,8 @@ // @JSON_VAR data var data = { "program": "MEME", - "version": "4.11.0", - "release": "Thu Nov 26 17:48:49 2015 +1000", + "version": "4.11.1", + "release": "Fri Jan 15 12:51:59 2016 -0800", "stop_reason": "Stopped because requested number of motifs (1) found.", "cmd": [ "meme", diff -r 3357222bd843 -r de3c73f58451 test-data/meme_output_txt_1.txt --- a/test-data/meme_output_txt_1.txt Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/meme_output_txt_1.txt Sun Jul 10 09:01:50 2016 -0400 @@ -1,7 +1,7 @@ ******************************************************************************** MEME - Motif discovery tool ******************************************************************************** -MEME version 4.11.0 (Release date: Thu Nov 26 17:48:49 2015 +1000) +MEME version 4.11.1 (Release date: Fri Jan 15 12:51:59 2016 -0800) For further information on how to interpret these results or to get a copy of the MEME software please access http://meme-suite.org . diff -r 3357222bd843 -r de3c73f58451 test-data/meme_output_txt_2.txt --- a/test-data/meme_output_txt_2.txt Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/meme_output_txt_2.txt Sun Jul 10 09:01:50 2016 -0400 @@ -1,7 +1,7 @@ ******************************************************************************** MEME - Motif discovery tool ******************************************************************************** -MEME version 4.11.0 (Release date: Thu Nov 26 17:48:49 2015 +1000) +MEME version 4.11.1 (Release date: Fri Jan 15 12:51:59 2016 -0800) For further information on how to interpret these results or to get a copy of the MEME software please access http://meme-suite.org . diff -r 3357222bd843 -r de3c73f58451 test-data/meme_output_xml_1.xml --- a/test-data/meme_output_xml_1.xml Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/meme_output_xml_1.xml Sun Jul 10 09:01:50 2016 -0400 @@ -161,7 +161,7 @@ ]> - + diff -r 3357222bd843 -r de3c73f58451 test-data/meme_output_xml_2.xml --- a/test-data/meme_output_xml_2.xml Thu Jul 07 09:53:04 2016 -0400 +++ b/test-data/meme_output_xml_2.xml Sun Jul 10 09:01:50 2016 -0400 @@ -161,7 +161,7 @@ ]> - + diff -r 3357222bd843 -r de3c73f58451 test-data/prior30.plib --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/prior30.plib Sun Jul 10 09:01:50 2016 -0400 @@ -0,0 +1,275 @@ +Alphabet= ACDEFGHIKLMNPQRSTVWY +NumDistr= 30 +Number= 0 +Mixture= 0.055795 +B= 5.623820 +Alpha= 0.0855491 0.0221831 0.0111063 0.0209959 0.0505726 0.025437 0.0155389 0.132951 0.0247865 0.150287 0.0577239 0.0209317 0.0166629 0.0220905 0.0244295 0.0497608 0.070277 0.157532 0.0102219 0.0309633 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= HMM9.4 reestimated in henikoff29.2 + +Number= 1 +Mixture= 0.198333 +B= 0.097240 +Alpha= 0.0562629 0.0329597 0.0692513 0.0385232 0.0400041 0.143573 0.0428939 0.0226244 0.0442102 0.0665467 0.0117853 0.0447655 0.0833299 0.0395825 0.0611271 0.0588852 0.0513472 0.0317153 0.0237865 0.0368161 +FullUpdate= 1 +QUpdate= 1 +StructID= 24 +Comment= Outside + +Number= 2 +Mixture= 0.043566 +B= 1.648336 +Alpha= 0.0144564 0.00845337 0.00785519 0.00864933 0.255959 0.0110815 0.0509526 0.0234533 0.0120443 0.0561967 0.015111 0.0190974 0.00857653 0.0167812 0.0164918 0.0197108 0.0151013 0.0252782 0.050139 0.364613 +FullUpdate= 1 +QUpdate= 1 +StructID= 26 +Comment= Inside + +Number= 3 +Mixture= 0.060170 +B= 2.595432 +Alpha= 0.0452144 0.00587917 0.169731 0.0751478 0.00749471 0.0845832 0.0369819 0.00610072 0.0548186 0.011029 0.00382749 0.212785 0.0206532 0.0416705 0.0280716 0.117267 0.0533742 0.00943157 0.00216149 0.0137784 +FullUpdate= 1 +QUpdate= 1 +StructID= 19 +Comment= Outside Alpha + +Number= 4 +Mixture= 0.065466 +B= 3.112271 +Alpha= 0.0361167 0.0049157 0.0134924 0.0461325 0.00557631 0.0209043 0.0302551 0.016425 0.307554 0.0338255 0.0139435 0.0360733 0.0127659 0.0873761 0.222668 0.0369042 0.0354442 0.0228891 0.00434827 0.0123906 +FullUpdate= 1 +QUpdate= 1 +StructID= 21 +Comment= Outside Beta + +Number= 5 +Mixture= 0.067614 +B= 2.053644 +Alpha= 0.0194362 0.00765176 0.00188738 0.00372898 0.0849894 0.00421787 0.00400459 0.152735 0.00407958 0.4568 0.106051 0.00304386 0.00545956 0.00900935 0.00605071 0.00519029 0.016255 0.0861045 0.00787965 0.0154248 +FullUpdate= 1 +QUpdate= 1 +StructID= 22 +Comment= Inside alpha + +Number= 6 +Mixture= 0.080724 +B= 2.138987 +Alpha= 0.0423172 0.0153891 0.00409306 0.00565735 0.0197117 0.00590607 0.00139926 0.307863 0.00544884 0.115721 0.0285808 0.00522771 0.00474851 0.00328193 0.00351054 0.00892385 0.0348922 0.380003 0.00117673 0.00614917 +FullUpdate= 1 +QUpdate= 1 +StructID= 23 +Comment= Inside beta + +Number= 7 +Mixture= 0.051030 +B= 3.878926 +Alpha= 0.0548123 0.000759746 0.144127 0.46019 0.00249502 0.0192754 0.0106535 0.00938765 0.0562429 0.0163148 0.00717389 0.0245612 0.0177482 0.0744802 0.0199233 0.0323535 0.0257651 0.018574 0.00087086 0.00429088 +FullUpdate= 1 +QUpdate= 1 +StructID= 23 +Comment= Alpha helix + +Number= 8 +Mixture= 0.103529 +B= 1.486325 +Alpha= 0.315754 0.0384546 0.0116388 0.0133665 0.0111126 0.107921 0.00752325 0.0154885 0.0111281 0.0231087 0.011626 0.0228375 0.0304785 0.0166632 0.0156345 0.186379 0.0954421 0.0546691 0.00351538 0.00725682 +FullUpdate= 1 +QUpdate= 1 +StructID= 23 +Comment= Beta strand + +Number= 9 +Mixture= 0.062940 +B= 8.221215 +Alpha= 0.0869919 0.00672577 0.0600995 0.10763 0.0153489 0.0378086 0.0325335 0.023388 0.113765 0.041623 0.0196906 0.0625344 0.0262599 0.0788667 0.0707399 0.0886634 0.0666777 0.0361472 0.00484308 0.0196629 +FullUpdate= 1 +QUpdate= 1 +StructID= 23 +Comment= Other + +Number= 10 +Mixture= 0.012518 +B= 38.955631 +Alpha= 0.732922 0.0145131 0.00623235 0.00951423 0.00717778 0.0289521 0.00351664 0.0125081 0.00886593 0.0183651 0.00832812 0.00670968 0.00364556 0.00622169 0.00812899 0.0582399 0.0205067 0.0394327 0.00207485 0.00414489 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= A + +Number= 11 +Mixture= 0.004953 +B= 381.562195 +Alpha= 0.00563239 0.959814 0.00144129 0.00213042 0.00158645 0.00168393 0.000989765 0.00325263 0.00148501 0.00343924 0.00168673 0.00159054 0.00121534 0.00129942 0.00195209 0.00296106 0.0039912 0.00266944 0.000327808 0.000851203 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= C + +Number= 12 +Mixture= 0.013849 +B= 90.727570 +Alpha= 0.00897115 0.00169015 0.859473 0.0360829 0.00269485 0.00606504 0.00469816 0.00400134 0.0047981 0.00514968 0.00208395 0.029754 0.00241276 0.0045506 0.00433816 0.0088208 0.00511143 0.00527448 0.00104469 0.00298475 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= D + +Number= 13 +Mixture= 0.008388 +B= 404.591034 +Alpha= 0.00241514 0.000413991 0.0122981 0.96369 0.000665578 0.00187461 0.00106904 0.00149214 0.00121548 0.00129791 0.000554145 0.00253496 0.000624495 0.00316839 0.00115045 0.00171781 0.001468 0.0014564 0.000278652 0.000614791 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= E + +Number= 14 +Mixture= 0.008064 +B= 83.323669 +Alpha= 0.00839779 0.00428348 0.00298116 0.00358128 0.850936 0.00329382 0.00196832 0.0130534 0.00320345 0.0351883 0.00729724 0.00287304 0.00358482 0.00218728 0.00264753 0.00833798 0.00418729 0.0120684 0.00448366 0.025446 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= F + +Number= 15 +Mixture= 0.032205 +B= 32.644871 +Alpha= 0.0234448 0.00236512 0.0112957 0.00811395 0.00248143 0.868718 0.00345598 0.00342985 0.00859682 0.0040966 0.00239339 0.012342 0.00423123 0.00440054 0.00795347 0.0165095 0.0065024 0.00550512 0.00140604 0.00275817 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= G + +Number= 16 +Mixture= 0.005033 +B= 35.520824 +Alpha= 0.0100058 0.00386024 0.0131498 0.0108984 0.0122851 0.00738691 0.722249 0.00521193 0.00686054 0.0150103 0.00673014 0.0367074 0.00625526 0.0429912 0.0234127 0.0187246 0.0128445 0.00837399 0.00390723 0.0331349 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= H + +Number= 17 +Mixture= 0.007454 +B= 101.265472 +Alpha= 0.0106938 0.00267663 0.00404166 0.00466637 0.00838963 0.00372808 0.00182575 0.681615 0.0059102 0.0770333 0.0184335 0.004676 0.0027124 0.00372663 0.00418165 0.00773357 0.0109237 0.140679 0.00140417 0.00494911 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= I + +Number= 18 +Mixture= 0.009400 +B= 150.415985 +Alpha= 0.00688657 0.00169711 0.00222738 0.00346887 0.00115861 0.00302866 0.00209171 0.00400905 0.903944 0.0037747 0.00186061 0.00449531 0.00249618 0.00324487 0.041775 0.00392196 0.00461714 0.00296607 0.000893256 0.00144282 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= K + +Number= 19 +Mixture= 0.017057 +B= 31.896633 +Alpha= 0.0114646 0.00367926 0.00296188 0.00596126 0.0190009 0.00382486 0.00338381 0.0401936 0.00650072 0.790038 0.031659 0.00392791 0.0050046 0.00753591 0.00771818 0.00748621 0.0101555 0.0312597 0.00242405 0.00581952 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= L + +Number= 20 +Mixture= 0.002761 +B= 201.346268 +Alpha= 0.00353933 0.00165628 0.0014931 0.00161065 0.00279831 0.00194259 0.00101868 0.00969101 0.00211316 0.0217036 0.928022 0.00162899 0.0015681 0.0015629 0.00138977 0.00294601 0.00311476 0.00723178 0.00156295 0.00340569 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= M + +Number= 21 +Mixture= 0.005734 +B= 108.343185 +Alpha= 0.0067512 0.00239062 0.0140378 0.0043452 0.00365788 0.00689345 0.0148828 0.00715373 0.00789036 0.00614036 0.00289697 0.858995 0.00399721 0.00770961 0.00570515 0.0238176 0.011602 0.00591549 0.00167893 0.00353897 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= N + +Number= 22 +Mixture= 0.022818 +B= 15.153304 +Alpha= 0.0417987 0.00360232 0.0113792 0.0152366 0.00564775 0.0123795 0.00606957 0.0091353 0.0165122 0.0167265 0.00490487 0.00915437 0.755604 0.0131375 0.012587 0.0283392 0.0189623 0.0140029 0.0012848 0.00353553 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= P + +Number= 23 +Mixture= 0.005931 +B= 79.417511 +Alpha= 0.0142993 0.00266984 0.0053289 0.0321605 0.0028715 0.00426743 0.0257509 0.00565307 0.0106106 0.0161186 0.00955753 0.0104696 0.00638107 0.807311 0.0149106 0.0111968 0.00889459 0.00681482 0.00206658 0.00266624 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= Q + +Number= 24 +Mixture= 0.011491 +B= 93.103897 +Alpha= 0.00756896 0.00314197 0.00296652 0.00327634 0.00194604 0.00467894 0.00721049 0.00406061 0.0277257 0.00663852 0.00217868 0.00577047 0.00473306 0.00953551 0.889701 0.00650859 0.00506022 0.00294281 0.00205549 0.00230062 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= R + +Number= 25 +Mixture= 0.008219 +B= 47.504795 +Alpha= 0.0284818 0.00697155 0.00749796 0.00604665 0.00515171 0.00954817 0.00380684 0.00637929 0.0104463 0.00908885 0.00471437 0.0194592 0.00711823 0.00611827 0.00979722 0.707416 0.139256 0.00656298 0.0015377 0.00460086 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= S + +Number= 26 +Mixture= 0.019050 +B= 14.027470 +Alpha= 0.0247201 0.00718027 0.00845584 0.0076239 0.00600101 0.0073401 0.00492149 0.0173757 0.0129878 0.0125773 0.0100452 0.0230424 0.00659406 0.0110314 0.0112037 0.107763 0.690341 0.0249364 0.00193884 0.00392074 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= T + +Number= 27 +Mixture= 0.007047 +B= 76.958153 +Alpha= 0.0447488 0.00734525 0.00576457 0.00805666 0.00714188 0.00593389 0.0041663 0.0688592 0.00714299 0.0255115 0.00800708 0.00501678 0.00632646 0.00492002 0.00812967 0.0100074 0.0240134 0.745035 0.00126243 0.00261056 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= V + +Number= 28 +Mixture= 0.003957 +B= 150.973328 +Alpha= 0.00517343 0.00213336 0.00350645 0.00390297 0.018439 0.0041919 0.0023655 0.00404231 0.00420998 0.0171406 0.00379068 0.00363696 0.00245861 0.00387467 0.00502035 0.00465674 0.00417283 0.00620977 0.888513 0.012561 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= W + +Number= 29 +Mixture= 0.004904 +B= 30.653225 +Alpha= 0.0342049 0.00809912 0.0126852 0.0174701 0.156033 0.0118268 0.0431342 0.0204751 0.0164439 0.0363664 0.0129811 0.0131986 0.0103037 0.0116235 0.0159032 0.0287792 0.0176143 0.024986 0.0131845 0.494687 +FullUpdate= 1 +QUpdate= 1 +StructID= 0 +Comment= Y + +/* $Header$ */ +/* $Header$ */ +/* $Header$ */ diff -r 3357222bd843 -r de3c73f58451 tool_dependencies.xml --- a/tool_dependencies.xml Thu Jul 07 09:53:04 2016 -0400 +++ b/tool_dependencies.xml Sun Jul 10 09:01:50 2016 -0400 @@ -1,9 +1,9 @@ - - + + - - + +