# HG changeset patch
# User iuc
# Date 1619699013 0
# Node ID d4d05a202bc3563356aaef6366e265f5ea3c1430
# Parent  a4962f14d05d2763181b0f5a6531bf00f45d0fa7
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/jasminesv/ commit 600a9e3c1d884e5cf106e4477c7b8223ef105cdb"

diff -r a4962f14d05d -r d4d05a202bc3 jasminesv.xml
--- a/jasminesv.xml	Wed Jan 20 19:49:13 2021 +0000
+++ b/jasminesv.xml	Thu Apr 29 12:23:33 2021 +0000
@@ -29,7 +29,7 @@
     'spec_reads=${spec_reads}'
     'spec_len=${spec_len}'
     #if $dup_to_ins.dup_to_ins:
-        'genome_file=reference.fa'
+        'genome_file=reference'
     #end if
 
     ## Flags:
@@ -156,7 +156,7 @@
                 <param name="dup_to_ins" value="--dup_to_ins"/>
                 <conditional name="reference_source">
                     <param name="reference_source_selector" value="history"/>
-                    <param name="ref_file" ftype="fasta" value="genome.fa"/>
+                    <param name="ref_file" ftype="fasta.gz" value="genome.fa.gz"/>
                 </conditional>
             </conditional>
             <output name="out_vcf" file="out1.vcf"/>
@@ -195,3 +195,4 @@
     ]]></help>
     <expand macro="citations"/>
 </tool>
+
diff -r a4962f14d05d -r d4d05a202bc3 macros.xml
--- a/macros.xml	Wed Jan 20 19:49:13 2021 +0000
+++ b/macros.xml	Thu Apr 29 12:23:33 2021 +0000
@@ -1,7 +1,7 @@
 <?xml version="1.0"?>
 <macros>
     <token name="@TOOL_VERSION@">1.0.11</token>
-    <token name="@VERSION_SUFFIX@">0</token>    
+    <token name="@VERSION_SUFFIX@">1</token>
     <token name="@PROFILE@">20.01</token>
     <xml name="requirements">
         <requirements>
@@ -27,9 +27,16 @@
     -->
     <token name="@REF_FASTA@"><![CDATA[
         #if $dup_to_ins.reference_source.reference_source_selector == 'history':
-            ln -f -s '$dup_to_ins.reference_source.ref_file' reference.fa &&
+            #set reference = $dup_to_ins.reference_source.ref_file
+            #set ext = $reference.ext
         #else:
-            ln -f -s '$dup_to_ins.reference_source.ref_file.fields.path' reference.fa &&
+            #set reference = $dup_to_ins.reference_source.ref_file.fields.path
+            #set ext = $dup_to_ins.reference_source.ref_file.fields.path
+        #end if
+        #if $ext.endswith(".gz"):
+            gunzip -c '$reference' > reference &&
+        #else:
+            ln -sf '$reference' reference &&
         #end if
     ]]></token>
 
@@ -49,7 +56,7 @@
                 </param>
             </when>
             <when value="history">
-                <param name="ref_file" type="data" format="fasta,fastq" label="Use the following dataset as the reference sequence" help="You can upload a FASTA or FASTQ sequence to the history and use it as reference"/>
+                <param name="ref_file" type="data" format="fasta,fasta.gz,fastq,fastq.gz" label="Use the following dataset as the reference sequence" help="You can upload a FASTA or FASTQ sequence to the history and use it as reference"/>
             </when>
         </conditional>
     </xml>
@@ -64,3 +71,4 @@
 More information is available in the `github <https://github.com/mkirsche/Jasmine>`_.
     ]]></token>
 </macros>
+
diff -r a4962f14d05d -r d4d05a202bc3 test-data/all_fasta.loc
--- a/test-data/all_fasta.loc	Wed Jan 20 19:49:13 2021 +0000
+++ b/test-data/all_fasta.loc	Thu Apr 29 12:23:33 2021 +0000
@@ -16,4 +16,4 @@
 #fasta file. So there will be multiple fasta files for each build,
 #such as with hg19 above.
 #
-jasmine	jasmine	jasmine	${__HERE__}/genome.fa
\ No newline at end of file
+jasmine	jasmine	jasmine	${__HERE__}/genome.fa.gz
diff -r a4962f14d05d -r d4d05a202bc3 test-data/genome.fa
--- a/test-data/genome.fa	Wed Jan 20 19:49:13 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,20 +0,0 @@
->1
-TAACCCTAACACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC
-TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAA
-CACGTACGTACGTACGTACGTACGTACTGACGTACGT
-AACCCTAACCCAA
-CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAAC
-CCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCT
-CACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAAACCCTAAACCC
-TAACCCTAACCCTAACCCTAACCCTAACCCCAACCCCAACCCCAACCCCA
-ACCCCAACCCCAACCCTAACCCCTAACCCTAACCCTAACCCTACCCTAAC
->2
-TAACCCTAACACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC
-TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAA
-CACGTACGTACGTACGTACGTACGTACTGACGTACGT
-AACCCTAACCCAA
-CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAAC
-CCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCT
-CACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAAACCCTAAACCC
-TAACCCTAACCCTAACCCTAACCCTAACCCCAACCCCAACCCCAACCCCA
-ACCCCAACCCCAACCCTAACCCCTAACCCTAACCCTAACCCTACCCTAAC
\ No newline at end of file
diff -r a4962f14d05d -r d4d05a202bc3 test-data/genome.fa.gz
Binary file test-data/genome.fa.gz has changed