Mercurial > repos > iuc > hmmer_hmmscan
comparison test-data/MADE1.out @ 6:d52b0e4bfa46 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
| author | iuc |
|---|---|
| date | Mon, 11 Jun 2018 15:49:34 -0400 |
| parents | 6313ad2f168f |
| children | d02bc72e520b |
comparison
equal
deleted
inserted
replaced
| 5:8e797aaf03fb | 6:d52b0e4bfa46 |
|---|---|
| 1 # hmmscan :: search sequence(s) against a profile database | 1 # hmmscan :: search sequence(s) against a profile database |
| 2 # HMMER 3.1b2 (February 2015); http://hmmer.org/ | 2 # HMMER 3.2 (June 2018); http://hmmer.org/ |
| 3 # Copyright (C) 2015 Howard Hughes Medical Institute. | 3 # Copyright (C) 2018 Howard Hughes Medical Institute. |
| 4 # Freely distributed under the GNU General Public License (GPLv3). | 4 # Freely distributed under the BSD open source license. |
| 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - | 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - |
| 6 # query sequence file: /tmp/tmpYWzicI/files/000/dataset_20.dat | 6 # query sequence file: /tmp/tmpp4O0Ju/files/000/dataset_20.dat |
| 7 # target HMM database: /tmp/tmpYWzicI/files/000/dataset_19.dat | 7 # target HMM database: localref.hmm |
| 8 # per-seq hits tabular output: /tmp/tmpYWzicI/files/000/dataset_22.dat | 8 # per-seq hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_22.dat |
| 9 # per-dom hits tabular output: /tmp/tmpYWzicI/files/000/dataset_23.dat | 9 # per-dom hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_23.dat |
| 10 # pfam-style tabular hit output: /tmp/tmpYWzicI/files/000/dataset_24.dat | 10 # pfam-style tabular hit output: /tmp/tmpp4O0Ju/files/000/dataset_24.dat |
| 11 # max ASCII text line length: unlimited | 11 # max ASCII text line length: unlimited |
| 12 # Vit filter P threshold: <= 0.001 | 12 # Vit filter P threshold: <= 0.001 |
| 13 # Fwd filter P threshold: <= 1e-05 | 13 # Fwd filter P threshold: <= 1e-05 |
| 14 # random number seed set to: 4 | 14 # random number seed set to: 4 |
| 15 # number of worker threads: 1 | 15 # number of worker threads: 1 |
| 18 Query: humanchr1/239220001-239550000 [L=330000] | 18 Query: humanchr1/239220001-239550000 [L=330000] |
| 19 Scores for complete sequence (score includes all domains): | 19 Scores for complete sequence (score includes all domains): |
| 20 --- full sequence --- --- best 1 domain --- -#dom- | 20 --- full sequence --- --- best 1 domain --- -#dom- |
| 21 E-value score bias E-value score bias exp N Model Description | 21 E-value score bias E-value score bias exp N Model Description |
| 22 ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- | 22 ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- |
| 23 1e-17 51.0 28.5 2.7e-12 33.7 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 23 5.7e-18 51.8 27.9 2e-12 34.1 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
| 24 | 24 |
| 25 | 25 |
| 26 Domain annotation for each model (and alignments): | 26 Domain annotation for each model (and alignments): |
| 27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
| 28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc | 28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc |
| 29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- | 29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- |
| 30 1 ? -4.2 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80 | 30 1 ? -4.5 0.0 1 1 30 54 .. 80044 80068 .. 80033 80072 .. 0.81 |
| 31 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 | 31 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 |
| 32 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62 | 32 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174577 .. 0.66 |
| 33 4 ! 33.7 0.7 2.7e-12 2.7e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 | 33 4 ! 34.1 0.7 2e-12 2e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 |
| 34 5 ? 2.9 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61 | 34 5 ? 2.8 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304022 304109 .. 0.62 |
| 35 | 35 |
| 36 Alignments for each domain: | 36 Alignments for each domain: |
| 37 == domain 1 score: -4.2 bits; conditional E-value: 1 | 37 == domain 1 score: -4.5 bits; conditional E-value: 1 |
| 38 xxxxxxxxxxxxxxxxxxxxxxxxx RF | 38 xxxxxxxxxxxxxxxxxxxxxxxxx RF |
| 39 MADE1 30 ttgccattacttttaatggcaaaaa 54 | 39 MADE1 30 ttgccattacttttaatggcaaaaa 54 |
| 40 t g catt ttt aatggcaaa a | 40 t g catt ttt aatggcaaa a |
| 41 humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 | 41 humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 |
| 42 45789****************9966 PP | 42 457899***************9865 PP |
| 43 | 43 |
| 44 == domain 2 score: -6.6 bits; conditional E-value: 1 | 44 == domain 2 score: -6.6 bits; conditional E-value: 1 |
| 45 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 45 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
| 46 MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 | 46 MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 |
| 47 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca | 47 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca |
| 48 humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 | 48 humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 |
| 49 78999999999999999999999984444444457777777899998876....77777888876 PP | 49 78999999999999999999999984444444457777777899988765....67777778776 PP |
| 50 | 50 |
| 51 == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10 | 51 == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10 |
| 52 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF | 52 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
| 53 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44 | 53 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 |
| 54 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt a | 54 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt |
| 55 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514 | 55 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 |
| 56 79***************************************964443333333333330 PP | 56 79**************************************996 PP |
| 57 | 57 |
| 58 == domain 4 score: 33.7 bits; conditional E-value: 2.7e-12 | 58 == domain 4 score: 34.1 bits; conditional E-value: 2e-12 |
| 59 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 59 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
| 60 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 | 60 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggca...aaaaccgcaattacttttgcaccaacctaa 80 |
| 61 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a + a t ctttt caccaa ctaa | 61 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa |
| 62 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 | 62 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTtttAAAA--G-TAATGCTTTTACACCAATCTAA 302466 |
| 63 56899******************************************963333233345578**************996 PP | 63 56899******************************************962223333..3.45578**************997 PP |
| 64 | 64 |
| 65 == domain 5 score: 2.9 bits; conditional E-value: 0.011 | 65 == domain 5 score: 2.8 bits; conditional E-value: 0.011 |
| 66 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 66 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
| 67 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 | 67 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 |
| 68 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa | 68 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa |
| 69 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 | 69 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 |
| 70 222222222222.3455779************************98765 PP | 70 222223222222.3556779************************98765 PP |
| 71 | 71 |
| 72 | 72 |
| 73 | 73 |
| 74 Internal pipeline statistics summary: | 74 Internal pipeline statistics summary: |
| 75 ------------------------------------- | 75 ------------------------------------- |
| 79 Passed bias filter: 1 (1); expected 0.0 (0.02) | 79 Passed bias filter: 1 (1); expected 0.0 (0.02) |
| 80 Passed Vit filter: 1 (1); expected 0.0 (0.001) | 80 Passed Vit filter: 1 (1); expected 0.0 (0.001) |
| 81 Passed Fwd filter: 1 (1); expected 0.0 (1e-05) | 81 Passed Fwd filter: 1 (1); expected 0.0 (1e-05) |
| 82 Initial search space (Z): 1 [actual number of targets] | 82 Initial search space (Z): 1 [actual number of targets] |
| 83 Domain search space (domZ): 1 [number of targets reported over threshold] | 83 Domain search space (domZ): 1 [number of targets reported over threshold] |
| 84 # CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16 | 84 # CPU time: 0.14u 0.01s 00:00:00.15 Elapsed: 00:00:00.14 |
| 85 # Mc/sec: 165.00 | 85 # Mc/sec: 177.58 |
| 86 // | 86 // |
| 87 [ok] | 87 [ok] |
