diff test-data/MADE1.nhmmscan_out @ 5:7f9c56f02437 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
author iuc
date Sat, 07 Apr 2018 03:47:27 -0400
parents
children 18729d247fdb
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.nhmmscan_out	Sat Apr 07 03:47:27 2018 -0400
@@ -0,0 +1,109 @@
+# nhmmscan :: search DNA sequence(s) against a DNA profile database
+# HMMER 3.1b2 (February 2015); http://hmmer.org/
+# Copyright (C) 2015 Howard Hughes Medical Institute.
+# Freely distributed under the GNU General Public License (GPLv3).
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+# query sequence file:             /tmp/tmpc_c3amjg/files/000/dataset_2.dat
+# target HMM database:             /tmp/tmpc_c3amjg/files/000/dataset_1.dat
+# per-seq hits tabular output:     /tmp/tmpc_c3amjg/files/000/dataset_4.dat
+# hits output in Dfam format:      /tmp/tmpc_c3amjg/files/000/dataset_5.dat
+# max ASCII text line length:      unlimited
+# Vit filter P threshold:       <= 0.001
+# Fwd filter P threshold:       <= 1e-05
+# random number seed set to:       4
+# number of worker threads:        1
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+
+Query:       humanchr1/239220001-239550000  [L=330000]
+Scores for complete hit:
+    E-value  score  bias  Model     start    end  Description
+    ------- ------ -----  --------  -----  -----  -----------
+    1.2e-10   38.6   7.4  MADE1    302390 302466  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    7.8e-08   29.6   8.3  MADE1    174456 174498  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    1.2e-07   28.9   6.0  MADE1    302466 302390  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    7.2e-06   23.3   7.0  MADE1    174493 174456  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+  ------ inclusion threshold ------
+        1.4    6.3   7.0  MADE1    304073 304104  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+
+
+Annotation for each hit  (and alignments):
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   38.6   7.4   1.2e-10         4        80 .]    302390    302466 ..    302387    302466 ..        80    0.87
+
+  Alignment:
+  score: 38.6 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80    
+                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    a aaa  g a  t ctttt caccaa ctaa
+  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466
+                                       899******************************************955533.443..334.4689***********99986 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   29.6   8.3   7.8e-08         1        43 [.    174456    174498 ..    174456    174518 ..        80    0.92
+
+  Alignment:
+  score: 29.6 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
+                                       ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
+  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
+                                       589************************************9975 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   28.9   6.0   1.2e-07         1        77 [.    302466    302390 ..    302466    302387 ..        80    0.74
+
+  Alignment:
+  score: 28.9 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77    
+                                       ttag ttggtg aaaag                cattactttt                aatggcaaaaacc caatt  ttttgcacc acc
+  humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
+                                       68999999999999998................5666777776222222222222222268****************************9998 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ !   23.3   7.0   7.2e-06        43        80 .]    174493    174456 ..    174513    174456 ..        80    0.91
+
+  Alignment:
+  score: 23.3 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80    
+                                       taatg caaaaacc caattacttttgcac aacctaa
+  humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
+                                       689********************************985 PP
+
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
+ ?    6.3   7.0       1.4        41        72 ..    304073    304104 ..    304053    304109 ..        80    0.85
+
+  Alignment:
+  score: 6.3 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     41 tttaatggcaaaaaccgcaattacttttgcac 72    
+                                       tt a tgg aaaaa   ca tta ttttgca 
+  humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
+                                       455779************************86 PP
+
+
+
+Internal pipeline statistics summary:
+-------------------------------------
+Query sequence(s):                         1  (660000 residues searched)
+Target model(s):                           1  (80 nodes)
+Residues passing SSV filter:             61794  (0.0936); expected (0.02)
+Residues passing bias filter:            46199  (0.07); expected (0.02)
+Residues passing Vit filter:              2752  (0.00417); expected (0.001)
+Residues passing Fwd filter:              2526  (0.00383); expected (1e-05)
+Total number of hits:                        5  (0.000405)
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
+# Mc/sec: 2640.00
+//
+[ok]