Mercurial > repos > iuc > hmmer_hmmbuild
diff test-data/nhmmer.out @ 2:9a0a34e55dee draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
| author | iuc |
|---|---|
| date | Sat, 25 Jun 2016 15:02:07 -0400 |
| parents | 648d9e133324 |
| children | ca0f80060539 |
line wrap: on
line diff
--- a/test-data/nhmmer.out Mon Oct 19 21:10:50 2015 -0400 +++ b/test-data/nhmmer.out Sat Jun 25 15:02:07 2016 -0400 @@ -1,12 +1,19 @@ # nhmmer :: search a DNA model or alignment against a DNA database -# HMMER 3.1b1 (May 2013); http://hmmer.org/ -# Copyright (C) 2013 Howard Hughes Medical Institute. +# HMMER 3.1b2 (February 2015); http://hmmer.org/ +# Copyright (C) 2015 Howard Hughes Medical Institute. # Freely distributed under the GNU General Public License (GPLv3). # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query file: test-data/MADE1.hmm -# target sequence database: test-data/dna_target.fa +# query file: /tmp/tmpprnvgs/files/000/dataset_1.dat +# target sequence database: /tmp/tmpprnvgs/files/000/dataset_2.dat +# hits tabular output: /tmp/tmpprnvgs/files/000/dataset_4.dat +# hits output in Dfam format: None # max ASCII text line length: unlimited -# number of worker threads: 8 +# SSV filter P threshold: <= 0.02 +# Vit filter P threshold: <= 0.001 +# Fwd filter P threshold: <= 1e-05 +# input query is asserted as: DNA +# random number seed set to: 4 +# number of worker threads: 1 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: MADE1 [M=80] @@ -15,35 +22,35 @@ Scores for complete hits: E-value score bias Sequence start end Description ------- ------ ----- -------- ----- ----- ----------- - 9.6e-11 38.8 7.4 humanchr1/239220001-239550000 302390 302466 - 6.5e-08 29.8 8.3 humanchr1/239220001-239550000 174456 174498 - 1e-07 29.2 6.0 humanchr1/239220001-239550000 302466 302390 - 6.2e-06 23.4 7.0 humanchr1/239220001-239550000 174493 174456 + 1.2e-10 38.6 7.4 humanchr1/239220001-239550000 302390 302466 + 7.8e-08 29.6 8.3 humanchr1/239220001-239550000 174456 174498 + 1.2e-07 28.9 6.0 humanchr1/239220001-239550000 302466 302390 + 7.2e-06 23.3 7.0 humanchr1/239220001-239550000 174493 174456 ------ inclusion threshold ------ 1.4 6.3 7.0 humanchr1/239220001-239550000 304073 304104 Annotation for each hit (and alignments): >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 38.8 7.4 9.6e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 Alignment: - score: 38.8 bits + score: 38.6 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 - 899******************************************955533.443..334.4689************9986 PP + 899******************************************955533.443..334.4689***********99986 PP >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 29.8 8.3 6.5e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 Alignment: - score: 29.8 bits + score: 29.6 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt @@ -51,12 +58,12 @@ 589************************************9975 PP >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 29.2 6.0 1e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.75 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 Alignment: - score: 29.2 bits + score: 28.9 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc @@ -64,21 +71,21 @@ 68999999999999998................5666777776222222222222222268****************************9998 PP >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 23.4 7.0 6.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 Alignment: - score: 23.4 bits + score: 23.3 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 taatg caaaaacc caattacttttgcac aacctaa humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 - 689********************************986 PP + 689********************************985 PP >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 Alignment: @@ -95,12 +102,12 @@ ------------------------------------- Query model(s): 1 (80 nodes) Target sequences: 1 (660000 residues searched) -Residues passing SSV filter: 61658 (0.0934); expected (0.02) -Residues passing bias filter: 45802 (0.0694); expected (0.02) -Residues passing Vit filter: 3544 (0.00537); expected (0.003) -Residues passing Fwd filter: 1934 (0.00293); expected (3e-05) +Residues passing SSV filter: 61794 (0.0936); expected (0.02) +Residues passing bias filter: 46199 (0.07); expected (0.02) +Residues passing Vit filter: 2752 (0.00417); expected (0.001) +Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) Total number of hits: 5 (0.000405) -# CPU time: 0.06u 0.00s 00:00:00.06 Elapsed: 00:00:00.05 -# Mc/sec: 1056.00 +# CPU time: 0.03u 0.00s 00:00:00.03 Elapsed: 00:00:00.03 +# Mc/sec: 1760.00 // [ok]