Mercurial > repos > iuc > hmmer_hmmbuild

comparison test-data/MADE1.out @ 2:9a0a34e55dee draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
author iuc
date Sat, 25 Jun 2016 15:02:07 -0400
parents 648d9e133324
children ca0f80060539
comparison
equal deleted inserted replaced
1:70e14e20a2e7 2:9a0a34e55dee
1 # hmmscan :: search sequence(s) against a profile database 1 # hmmscan :: search sequence(s) against a profile database
2 # HMMER 3.1b1 (May 2013); http://hmmer.org/ 2 # HMMER 3.1b2 (February 2015); http://hmmer.org/
3 # Copyright (C) 2013 Howard Hughes Medical Institute. 3 # Copyright (C) 2015 Howard Hughes Medical Institute.
4 # Freely distributed under the GNU General Public License (GPLv3). 4 # Freely distributed under the GNU General Public License (GPLv3).
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query sequence file: test-data/dna_target.fa 6 # query sequence file: /tmp/tmpYWzicI/files/000/dataset_20.dat
7 # target HMM database: test-data/MADE1.hmm 7 # target HMM database: /tmp/tmpYWzicI/files/000/dataset_19.dat
8 # per-seq hits tabular output: t.tbl 8 # per-seq hits tabular output: /tmp/tmpYWzicI/files/000/dataset_22.dat
9 # per-dom hits tabular output: t.domtbl 9 # per-dom hits tabular output: /tmp/tmpYWzicI/files/000/dataset_23.dat
10 # pfam-style tabular hit output: t.pfamtbl 10 # pfam-style tabular hit output: /tmp/tmpYWzicI/files/000/dataset_24.dat
11 # max ASCII text line length: unlimited 11 # max ASCII text line length: unlimited
12 # Vit filter P threshold: <= 0.001 12 # Vit filter P threshold: <= 0.001
13 # Fwd filter P threshold: <= 1e-05 13 # Fwd filter P threshold: <= 1e-05
14 # random number seed set to: 4 14 # random number seed set to: 4
15 # number of worker threads: 1
15 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 16 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
16 17
17 Query: humanchr1/239220001-239550000 [L=330000] 18 Query: humanchr1/239220001-239550000 [L=330000]
18 Scores for complete sequence (score includes all domains): 19 Scores for complete sequence (score includes all domains):
19 --- full sequence --- --- best 1 domain --- -#dom- 20 --- full sequence --- --- best 1 domain --- -#dom-
20 E-value score bias E-value score bias exp N Model Description 21 E-value score bias E-value score bias exp N Model Description
21 ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- 22 ------- ------ ----- ------- ------ ----- ---- -- -------- -----------
22 7.1e-18 51.5 28.5 2e-12 34.0 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 23 1e-17 51.0 28.5 2.7e-12 33.7 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
23 24
24 25
25 Domain annotation for each model (and alignments): 26 Domain annotation for each model (and alignments):
26 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
27 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc 28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc
28 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- 29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ----
29 1 ? -4.3 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80 30 1 ? -4.2 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80
30 2 ? -6.7 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 31 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75
31 3 ! 27.6 0.7 2e-10 2e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62 32 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62
32 4 ! 34.0 0.7 2e-12 2e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 33 4 ! 33.7 0.7 2.7e-12 2.7e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86
33 5 ? 2.8 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61 34 5 ? 2.9 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61
34 35
35 Alignments for each domain: 36 Alignments for each domain:
36 == domain 1 score: -4.3 bits; conditional E-value: 1 37 == domain 1 score: -4.2 bits; conditional E-value: 1
37 xxxxxxxxxxxxxxxxxxxxxxxxx RF 38 xxxxxxxxxxxxxxxxxxxxxxxxx RF
38 MADE1 30 ttgccattacttttaatggcaaaaa 54 39 MADE1 30 ttgccattacttttaatggcaaaaa 54
39 t g catt ttt aatggcaaa a 40 t g catt ttt aatggcaaa a
40 humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 41 humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068
41 45789****************9966 PP 42 45789****************9966 PP
42 43
43 == domain 2 score: -6.7 bits; conditional E-value: 1 44 == domain 2 score: -6.6 bits; conditional E-value: 1
44 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 45 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
45 MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 46 MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71
46 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca 47 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca
47 humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 48 humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072
48 78999999999999999999999984444444457777777899998876....77777888876 PP 49 78999999999999999999999984444444457777777899998876....77777888876 PP
49 50
50 == domain 3 score: 27.6 bits; conditional E-value: 2e-10 51 == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10
51 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF 52 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF
52 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44 53 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44
53 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt a 54 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt a
54 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514 55 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514
55 79***************************************964443333333333330 PP 56 79***************************************964443333333333330 PP
56 57
57 == domain 4 score: 34.0 bits; conditional E-value: 2e-12 58 == domain 4 score: 33.7 bits; conditional E-value: 2.7e-12
58 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 59 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
59 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 60 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80
60 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a + a t ctttt caccaa ctaa 61 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a + a t ctttt caccaa ctaa
61 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 62 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466
62 56899******************************************963333233345578**************997 PP 63 56899******************************************963333233345578**************996 PP
63 64
64 == domain 5 score: 2.8 bits; conditional E-value: 0.011 65 == domain 5 score: 2.9 bits; conditional E-value: 0.011
65 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 66 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
66 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 67 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75
67 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa 68 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa
68 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 69 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107
69 222222222222.3455779************************98765 PP 70 222222222222.3455779************************98765 PP
70 71
71 72
78 Passed bias filter: 1 (1); expected 0.0 (0.02) 79 Passed bias filter: 1 (1); expected 0.0 (0.02)
79 Passed Vit filter: 1 (1); expected 0.0 (0.001) 80 Passed Vit filter: 1 (1); expected 0.0 (0.001)
80 Passed Fwd filter: 1 (1); expected 0.0 (1e-05) 81 Passed Fwd filter: 1 (1); expected 0.0 (1e-05)
81 Initial search space (Z): 1 [actual number of targets] 82 Initial search space (Z): 1 [actual number of targets]
82 Domain search space (domZ): 1 [number of targets reported over threshold] 83 Domain search space (domZ): 1 [number of targets reported over threshold]
83 # CPU time: 0.52u 0.03s 00:00:00.55 Elapsed: 00:00:00.54 84 # CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16
84 # Mc/sec: 48.89 85 # Mc/sec: 165.00
85 // 86 //
86 [ok] 87 [ok]