Mercurial > repos > iuc > hmmer_hmmbuild
comparison test-data/MADE1.out @ 9:5c83ba4417e6 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
| author | iuc |
|---|---|
| date | Wed, 21 Jul 2021 14:04:14 +0000 |
| parents | e0cb3d4bc688 |
| children |
comparison
equal
deleted
inserted
replaced
| 8:84159da667ec | 9:5c83ba4417e6 |
|---|---|
| 1 # hmmscan :: search sequence(s) against a profile database | 1 # hmmscan :: search sequence(s) against a profile database |
| 2 # HMMER 3.3 (Nov 2019); http://hmmer.org/ | 2 # HMMER 3.3.2 (Nov 2020); http://hmmer.org/ |
| 3 # Copyright (C) 2019 Howard Hughes Medical Institute. | 3 # Copyright (C) 2020 Howard Hughes Medical Institute. |
| 4 # Freely distributed under the BSD open source license. | 4 # Freely distributed under the BSD open source license. |
| 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - | 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - |
| 6 # query sequence file: /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat | 6 # query sequence file: /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat |
| 7 # target HMM database: localref.hmm | 7 # target HMM database: localref.hmm |
| 8 # per-seq hits tabular output: /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat | 8 # per-seq hits tabular output: /tmp/tmpgjabmh94/files/9/8/3/dataset_9834554f-8f1e-4161-9c16-f4bd5042207c.dat |
| 9 # per-dom hits tabular output: /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat | 9 # per-dom hits tabular output: /tmp/tmpgjabmh94/files/8/e/b/dataset_8ebf81cb-d0c9-41a3-a725-c9e2f0d65d82.dat |
| 10 # pfam-style tabular hit output: /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat | 10 # pfam-style tabular hit output: /tmp/tmpgjabmh94/files/1/f/0/dataset_1f08bd39-0984-447e-b71e-7bf3442d708d.dat |
| 11 # max ASCII text line length: unlimited | 11 # max ASCII text line length: unlimited |
| 12 # Vit filter P threshold: <= 0.001 | 12 # Vit filter P threshold: <= 0.001 |
| 13 # Fwd filter P threshold: <= 1e-05 | 13 # Fwd filter P threshold: <= 1e-05 |
| 14 # random number seed set to: 4 | 14 # random number seed set to: 4 |
| 15 # number of worker threads: 1 | 15 # number of worker threads: 0 |
| 16 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - | 16 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - |
| 17 | 17 |
| 18 Query: humanchr1/239220001-239550000 [L=330000] | 18 Query: humanchr1/239220001-239550000 [L=59940] |
| 19 Scores for complete sequence (score includes all domains): | 19 Scores for complete sequence (score includes all domains): |
| 20 --- full sequence --- --- best 1 domain --- -#dom- | 20 --- full sequence --- --- best 1 domain --- -#dom- |
| 21 E-value score bias E-value score bias exp N Model Description | 21 E-value score bias E-value score bias exp N Model Description |
| 22 ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- | 22 ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- |
| 23 9.3e-18 51.2 26.3 1.3e-12 34.8 0.7 8.6 4 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 23 |
| 24 [No hits detected that satisfy reporting thresholds] | |
| 24 | 25 |
| 25 | 26 |
| 26 Domain annotation for each model (and alignments): | 27 Domain annotation for each model (and alignments): |
| 27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
| 28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc | |
| 29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- | |
| 30 1 ! 27.4 0.6 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174520 .. 0.93 | |
| 31 2 ? -8.4 5.8 1 1 12 79 .. 197274 197341 .. 197272 197342 .. 0.86 | |
| 32 3 ! 34.8 0.7 1.3e-12 1.3e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.87 | |
| 33 4 ? 1.4 0.4 0.033 0.033 27 74 .. 304060 304106 .. 304029 304108 .. 0.71 | |
| 34 | 28 |
| 35 Alignments for each domain: | 29 [No targets detected that satisfy reporting thresholds] |
| 36 == domain 1 score: 27.4 bits; conditional E-value: 2.4e-10 | |
| 37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
| 38 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 | |
| 39 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt | |
| 40 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 | |
| 41 79**************************************997 PP | |
| 42 | |
| 43 == domain 2 score: -8.4 bits; conditional E-value: 1 | |
| 44 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
| 45 MADE1 12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79 | |
| 46 caa gtaatt + tttt c att ttt t c aaa c c tta tt t ac a cta | |
| 47 humanchr1/239220001-239550000 197274 CAATGGTAATTTTATTTTTAACTATTTTATTTTTTAACTAAACTCACTTTTATTTATTTACATATCTA 197341 | |
| 48 567789*******************999999999999*****99999999999988877777776666 PP | |
| 49 | |
| 50 == domain 3 score: 34.8 bits; conditional E-value: 1.3e-12 | |
| 51 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
| 52 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 | |
| 53 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a a t ctttt caccaa ctaa | |
| 54 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 | |
| 55 6799*****************************************99953333333345578**************997 PP | |
| 56 | |
| 57 == domain 4 score: 1.4 bits; conditional E-value: 0.033 | |
| 58 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
| 59 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74 | |
| 60 tttt g c ta tt a tgg aaaaa + ca tta ttttgca a | |
| 61 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106 | |
| 62 334444443333.356788*************************9766 PP | |
| 63 | |
| 64 | 30 |
| 65 | 31 |
| 66 Internal pipeline statistics summary: | 32 Internal pipeline statistics summary: |
| 67 ------------------------------------- | 33 ------------------------------------- |
| 68 Query sequence(s): 1 (330000 residues searched) | 34 Query sequence(s): 1 (59940 residues searched) |
| 69 Target model(s): 1 (80 nodes) | 35 Target model(s): 1 (80 nodes) |
| 70 Passed MSV filter: 1 (1); expected 0.0 (0.02) | 36 Passed MSV filter: 0 (0); expected 0.0 (0.02) |
| 71 Passed bias filter: 1 (1); expected 0.0 (0.02) | 37 Passed bias filter: 0 (0); expected 0.0 (0.02) |
| 72 Passed Vit filter: 1 (1); expected 0.0 (0.001) | 38 Passed Vit filter: 0 (0); expected 0.0 (0.001) |
| 73 Passed Fwd filter: 1 (1); expected 0.0 (1e-05) | 39 Passed Fwd filter: 0 (0); expected 0.0 (1e-05) |
| 74 Initial search space (Z): 1 [actual number of targets] | 40 Initial search space (Z): 1 [actual number of targets] |
| 75 Domain search space (domZ): 1 [number of targets reported over threshold] | 41 Domain search space (domZ): 0 [number of targets reported over threshold] |
| 76 # CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22 | 42 # CPU time: 0.00u 0.00s 00:00:00.00 Elapsed: 00:00:00.00 |
| 77 # Mc/sec: 117.29 | 43 # Mc/sec: 7920.43 |
| 78 // | 44 // |
| 79 [ok] | 45 [ok] |
