diff test-data/nhmmer.out @ 0:858df076118a draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 86a44bf15f8184b690ee1af98aa1d5f86ad2fb3d-dirty
author iuc
date Fri, 02 Oct 2015 13:39:33 -0400
parents
children 706f272440c8
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nhmmer.out	Fri Oct 02 13:39:33 2015 -0400
@@ -0,0 +1,106 @@
+# nhmmer :: search a DNA model or alignment against a DNA database
+# HMMER 3.1b1 (May 2013); http://hmmer.org/
+# Copyright (C) 2013 Howard Hughes Medical Institute.
+# Freely distributed under the GNU General Public License (GPLv3).
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+# query file:                      test-data/MADE1.hmm
+# target sequence database:        test-data/dna_target.fa
+# max ASCII text line length:      unlimited
+# number of worker threads:        8
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+
+Query:       MADE1  [M=80]
+Accession:   DF0000629.2
+Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+Scores for complete hits:
+    E-value  score  bias  Sequence                       start    end  Description
+    ------- ------ -----  --------                       -----  -----  -----------
+    9.6e-11   38.8   7.4  humanchr1/239220001-239550000 302390 302466  
+    6.5e-08   29.8   8.3  humanchr1/239220001-239550000 174456 174498  
+      1e-07   29.2   6.0  humanchr1/239220001-239550000 302466 302390  
+    6.2e-06   23.4   7.0  humanchr1/239220001-239550000 174493 174456  
+  ------ inclusion threshold ------
+        1.4    6.3   7.0  humanchr1/239220001-239550000 304073 304104  
+
+
+Annotation for each hit  (and alignments):
+>> humanchr1/239220001-239550000  
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to    sq len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- --------- ---------    ----
+ !   38.8   7.4   9.6e-11         4        80 .]    302390    302466 ..    302387    302466 ..    330000    0.87
+
+  Alignment:
+  score: 38.8 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80    
+                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    a aaa  g a  t ctttt caccaa ctaa
+  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466
+                                       899******************************************955533.443..334.4689************9986 PP
+
+>> humanchr1/239220001-239550000  
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to    sq len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- --------- ---------    ----
+ !   29.8   8.3   6.5e-08         1        43 [.    174456    174498 ..    174456    174518 ..    330000    0.92
+
+  Alignment:
+  score: 29.8 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
+                                       ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
+  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
+                                       589************************************9975 PP
+
+>> humanchr1/239220001-239550000  
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to    sq len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- --------- ---------    ----
+ !   29.2   6.0     1e-07         1        77 [.    302466    302390 ..    302466    302387 ..    330000    0.75
+
+  Alignment:
+  score: 29.2 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77    
+                                       ttag ttggtg aaaag                cattactttt                aatggcaaaaacc caatt  ttttgcacc acc
+  humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
+                                       68999999999999998................5666777776222222222222222268****************************9998 PP
+
+>> humanchr1/239220001-239550000  
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to    sq len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- --------- ---------    ----
+ !   23.4   7.0   6.2e-06        43        80 .]    174493    174456 ..    174513    174456 ..    330000    0.91
+
+  Alignment:
+  score: 23.4 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80    
+                                       taatg caaaaacc caattacttttgcac aacctaa
+  humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
+                                       689********************************986 PP
+
+>> humanchr1/239220001-239550000  
+    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to    sq len      acc
+   ------ ----- ---------   -------   -------    --------- ---------    --------- --------- ---------    ----
+ ?    6.3   7.0       1.4        41        72 ..    304073    304104 ..    304053    304109 ..    330000    0.85
+
+  Alignment:
+  score: 6.3 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     41 tttaatggcaaaaaccgcaattacttttgcac 72    
+                                       tt a tgg aaaaa   ca tta ttttgca 
+  humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
+                                       455779************************86 PP
+
+
+
+Internal pipeline statistics summary:
+-------------------------------------
+Query model(s):                              1  (80 nodes)
+Target sequences:                            1  (660000 residues searched)
+Residues passing SSV filter:             61658  (0.0934); expected (0.02)
+Residues passing bias filter:            45802  (0.0694); expected (0.02)
+Residues passing Vit filter:              3544  (0.00537); expected (0.003)
+Residues passing Fwd filter:              1934  (0.00293); expected (3e-05)
+Total number of hits:                        5  (0.000405)
+# CPU time: 0.06u 0.00s 00:00:00.06 Elapsed: 00:00:00.05
+# Mc/sec: 1056.00
+//
+[ok]