Mercurial > repos > iuc > glimmer_not_knowledge_based

comparison glimmer_wo_icm.xml @ 0:7ac31bffa17e draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
author iuc
date Tue, 28 Nov 2017 09:55:59 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:7ac31bffa17e
1 <tool id="glimmer_not_knowledge_based" name="Glimmer3" version="@WRAPPER_VERSION@">
2 <description>Predict ORFs in prokaryotic genomes (not knowlegde-based)</description>
3 <macros>
4 <import>macros.xml</import>
5 </macros>
6 <expand macro="requirements"/>
7 <command><![CDATA[
8 python '$__tool_directory__/glimmer_wo_icm.py'
9 '$input'
10 #if $report:
11 '$prediction'
12 #else:
13 'None'
14 #end if
15 #if $detailed_report:
16 '$detailed'
17 #else:
18 'None'
19 #end if
20 $overlap
21 $gene_length
22 $threshold
23 $linear
24 '$genes_output'
25 ]]></command>
26 <inputs>
27 <param name="input" type="data" format="fasta" label="Genome sequence" />
28 <param name="overlap" type="integer" value="0" label="Set maximum overlap length. Overlaps this short or shorter are ignored." />
29 <param name="gene_length" type="integer" value="110" label="Set minimum gene length." />
30 <param name="threshold" type="integer" value="30" label="Set threshold score for calling as gene. If the in-frame score >= N, then the region is given a number and considered a potential gene." />
31 <param name="linear" type="boolean" truevalue="true" falsevalue="false" checked="true" label="Assume linear rather than circular genome, i.e., no wraparound" />
32
33 <param name="detailed_report" type="boolean" truevalue="" falsevalue="" checked="false" label="Output a detailed gene prediction report as separate file" />
34 <param name="report" type="boolean" truevalue="" falsevalue="" checked="false" label="Report the classic glimmer table output" />
35 </inputs>
36 <outputs>
37 <data name="genes_output" format="fasta" label="Glimmer3 on ${on_string} (Gene Prediction FASTA)" />
38 <data name="prediction" format="txt" label="Glimmer3 on ${on_string} (Gene Prediction table)">
39 <filter>report == True</filter>
40 </data>
41 <data name="detailed" format="txt" label="Glimmer3 on ${on_string} (detailed report)">
42 <filter>detailed_report == True</filter>
43 </data>
44 </outputs>
45 <tests>
46 <test>
47 <param name="input" value="streptomyces_Tue6071_plasmid_genomic.fasta" />
48 <param name="overlap" value="0" />
49 <param name="gene_length" value="110" />
50 <param name="threshold" value="30" />
51 <param name="linear" value="true" />
52 <param name="detailed_report" value="" />
53 <param name="report" value="" />
54 <output name="genes_output" file="glimmer_wo_icm_trans-table-11_plasmid_genomic.fasta" ftype="fasta" />
55 </test>
56 </tests>
57 <help>
58 <![CDATA[
59
60 **What it does**
61
62 This tool predicts open reading frames (ORFs) from a given DNA Sequence. That tool is not knowlegde-based.
63
64 The recommended way is to use a trained Glimmer3 with ICM model. Use the knowlegde-based version for that and insert/generate a training set.
65
66 -----
67
68 **Glimmer Overview**
69
70 ::
71
72 ************** ************** ************** **************
73 * * * * * * * *
74 * long-orfs * ===> * Extract * ===> * build-icm * ===> * glimmer3 *
75 * * * * * * * *
76 ************** ************** ************** **************
77
78 -----
79
80 **Example**
81
82 Suppose you have the following DNA sequences::
83
84 >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
85 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
86 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
87 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
88 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
89 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
90 .......
91
92 Running this tool will produce a FASTA file with predicted genes and glimmer output files like the following::
93
94 >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
95 orf00001 577 699 +1 5.24
96 orf00003 800 1123 +2 5.18
97 orf00004 1144 3813 +1 10.62
98 orf00006 3857 6220 +2 6.07
99 orf00007 6226 7173 +1 1.69
100 orf00008 7187 9307 +2 8.95
101 orf00009 9424 10410 +1 8.29
102 orf00010 10515 11363 +3 7.00
103 orf00011 11812 11964 +1 2.80
104 orf00012 12360 13457 +3 4.80
105 orf00013 14379 14044 -1 7.41
106 orf00015 15029 14739 -3 12.43
107 orf00016 15066 15227 +3 1.91
108 orf00020 16061 15351 -3 2.83
109 orf00021 17513 17391 -3 2.20
110 orf00023 17529 17675 +3 0.11
111
112
113
114 ]]>
115 </help>
116 <expand macro="citation" />
117 </tool>