# HG changeset patch
# User iuc
# Date 1589059633 0
# Node ID 9686521fda0ece5aabb6a8a304f9d0f66e3a773f
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/data_managers/data_manager_vsnp_genbank commit 31f4453e44da62788efd01736ed57ad483383b09"
diff -r 000000000000 -r 9686521fda0e data_manager/vsnp_genbank_fetcher.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/vsnp_genbank_fetcher.py Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,66 @@
+import argparse
+import json
+import os
+import sys
+try:
+ # For Python 3.0 and later
+ from urllib.request import Request, urlopen
+except ImportError:
+ # Fall back to Python 2 imports
+ from urllib2 import Request, urlopen
+
+
+def url_download(url, workdir):
+ file_path = os.path.abspath(os.path.join(workdir, os.path.basename(url)))
+ src = None
+ dst = None
+ try:
+ req = Request(url)
+ src = urlopen(req)
+ with open(file_path, 'wb') as dst:
+ while True:
+ chunk = src.read(2**10)
+ if chunk:
+ dst.write(chunk)
+ else:
+ break
+ except Exception as e:
+ sys.exit(str(e))
+ finally:
+ if src:
+ src.close()
+ return file_path
+
+
+def download(dbkey, name, url, out_file):
+
+ with open(out_file) as fh:
+ params = json.loads(fh.read())
+
+ workdir = params['output_data'][0]['extra_files_path']
+ os.makedirs(workdir)
+ file_path = url_download(url, workdir)
+ entry_name = os.path.basename(file_path)
+
+ data_manager_json = {"data_tables": {}}
+ data_manager_entry = {}
+ data_manager_entry['value'] = dbkey
+ data_manager_entry['name'] = entry_name
+ data_manager_entry['path'] = file_path
+ data_manager_entry['description'] = "Genbank file for %s" % name
+ data_manager_json["data_tables"]["vsnp_genbank"] = data_manager_entry
+
+ with open(out_file, 'w') as fh:
+ fh.write(json.dumps(data_manager_json, sort_keys=True))
+
+
+parser = argparse.ArgumentParser()
+
+parser.add_argument('--dbkey', dest='dbkey', help='Genome reference dbkey')
+parser.add_argument('--name', dest='name', help='Reference display name')
+parser.add_argument('--url', dest='url', help='URL to download Genbank file')
+parser.add_argument('--out_file', dest='out_file', help='JSON output file')
+
+args = parser.parse_args()
+
+download(args.dbkey, args.name, args.url, args.out_file)
diff -r 000000000000 -r 9686521fda0e data_manager/vsnp_genbank_fetcher.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/vsnp_genbank_fetcher.xml Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,103 @@
+
+
+ Download vSNP Genbank files
+
+ python
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r 9686521fda0e data_manager_conf.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager_conf.xml Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,21 @@
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r 9686521fda0e test-data/AF2122.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/AF2122.fa Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,11 @@
+>NC_002945.4 Mycobacterium bovis AF2122/97 genome assembly, chromosome: Mycobacterium_bovis_AF2122/97
+TTGACCGATGACCCCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGAACTTAACGGCGACC
+CTAAGGTTGACGACGGACCCAGCAGTGATGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTG
+GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTATCCGTGCCGAGCAGCTTTGTC
+CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACCGACGCTCTCAGCCGCCGACTCGGACATCAGA
+TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGCCGACGACACTACCGTGCCGCCTTCCGA
+AAATCCTGCTACCACATCGCCAGACACCACAACCGACAACGACGAGATTGATGACAGCGCTGCGGCACGG
+GGCGATAACCAGCACAGTTGGCCAAGTTACTTCACCGAGCGCCCGCGCAATACCGATTCCGCTACCGCTG
+GCGTAACCAGCCTTAACCGTCGCTACACCTTTGATACGTTCGTTATCGGCGCCTCCAACCGGTTCGCGCA
+CGCCGCCGCCTTGGCGATCGCAGAAGCACCCGCCCGCGCTTACAACCCCCTGTTCATCTGGGGCGAGTCC
+GGTCTCGGCAAGACACACCTGCTACACGCGGCAGGCAACTATGCCCAACGGTTGTTCCCGGGAATGCGGG
diff -r 000000000000 -r 9686521fda0e test-data/all_fasta.loc
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/all_fasta.loc Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,19 @@
+#This file lists the locations and dbkeys of all the fasta files
+#under the "genome" directory (a directory that contains a directory
+#for each build). The script extract_fasta.py will generate the file
+#all_fasta.loc. This file has the format (white space characters are
+#TAB characters):
+#
+#
+#
+#So, all_fasta.loc could look something like this:
+#
+#apiMel3 apiMel3 Honeybee (Apis mellifera): apiMel3 /path/to/genome/apiMel3/apiMel3.fa
+#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /path/to/genome/hg19/hg19canon.fa
+#hg19full hg19 Human (Homo sapiens): hg19 Full /path/to/genome/hg19/hg19full.fa
+#
+#Your all_fasta.loc file should contain an entry for each individual
+#fasta file. So there will be multiple fasta files for each build,
+#such as with hg19 above.
+#
+AF2122 AF2122 AF2122 ${__HERE__}/AF2122.fa
diff -r 000000000000 -r 9686521fda0e test-data/vsnp_genbank.json
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/vsnp_genbank.json Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,1 @@
+{"data_tables": {"vsnp_genbank": {"description": "Genbank file for AF2122", "name": "NC_002945v4.gbk", "path":
diff -r 000000000000 -r 9686521fda0e test-data/vsnp_genbank.loc
diff -r 000000000000 -r 9686521fda0e tool-data/all_fasta.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/all_fasta.loc.sample Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,18 @@
+#This file lists the locations and dbkeys of all the fasta files
+#under the "genome" directory (a directory that contains a directory
+#for each build). The script extract_fasta.py will generate the file
+#all_fasta.loc. This file has the format (white space characters are
+#TAB characters):
+#
+#
+#
+#So, all_fasta.loc could look something like this:
+#
+#apiMel3 apiMel3 Honeybee (Apis mellifera): apiMel3 /path/to/genome/apiMel3/apiMel3.fa
+#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /path/to/genome/hg19/hg19canon.fa
+#hg19full hg19 Human (Homo sapiens): hg19 Full /path/to/genome/hg19/hg19full.fa
+#
+#Your all_fasta.loc file should contain an entry for each individual
+#fasta file. So there will be multiple fasta files for each build,
+#such as with hg19 above.
+#
diff -r 000000000000 -r 9686521fda0e tool-data/vsnp_genbank.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/vsnp_genbank.loc.sample Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,4 @@
+## vSNP Genbank files
+#Value Name Path Description
+#AF2122 Mycobacterium_AF2122/NC_002945v4.gbk vsnp/AF2122/Mycobacterium_AF2122/NC_002945v4.gbk Genbank file for Mycobacterium bovis AF2122/97
+#NC_006932 Brucella_abortus1/NC_006932-NC_006933.gbk vsnp/NC_006932/Brucella_abortus1/NC_006932-NC_006933.gbk Genbank file for Brucella abortus bv. 1 str. 9-941
diff -r 000000000000 -r 9686521fda0e tool_data_table_conf.xml.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,13 @@
+
+
+
+ value, dbkey, name, path
+
+
+
+
+ value, name, path, description
+
+
+
+
diff -r 000000000000 -r 9686521fda0e tool_data_table_conf.xml.test
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test Sat May 09 21:27:13 2020 +0000
@@ -0,0 +1,12 @@
+
+
+
+ value, dbkey, name, path
+
+
+
+
+ value, name, path, description
+
+
+