# HG changeset patch # User iuc # Date 1498945576 14400 # Node ID 0d0d8d8823155bd34af6413753f07f3eb0bca73b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/crossmap commit 8564863eaad7bb9f9c8c273d471511979a2c96aa diff -r 000000000000 -r 0d0d8d882315 README.rst --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/README.rst Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,7 @@ +CrossMap wrapper for Galaxy +=========================== + +CrossMap is versatile tool to convert genome coordinates or annotation files between genome +assemblies. It supports mostly commonly used file types, including BAM, BED,BigWig, GFF, +GTF, SAM, Wiggle, and VCF formats. For large plain text file types, such as BED, GFF, GTF +and VCF, reading from remote servers and file compression are supported. diff -r 000000000000 -r 0d0d8d882315 crossmap_wig.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/crossmap_wig.xml Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,76 @@ + + Convert genome coordinates or annotation files between genome assemblies + + macros.xml + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + `__ for more details +]]> + + + 10.1093/bioinformatics/btt730 + + diff -r 000000000000 -r 0d0d8d882315 macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,56 @@ + + + + + ucsc-wigtobigwig + crossmap + + + + 0.2.2 + + + + + + + + + CrossMap.py 2>&1 | head -n 1 | grep -E --only-matching 'CrossMap.*' + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +CrossMap +-------- +CrossMap is versatile tool to convert genome coordinates or annotation files between genome +assemblies. It supports mostly commonly used file types, including BAM, BED,BigWig, GFF, +GTF, SAM, Wiggle, and VCF formats. For large plain text file types, such as BED, GFF, GTF +and VCF, reading from remote servers and file compression are supported. + + diff -r 000000000000 -r 0d0d8d882315 test-data/aToB.over.chain --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/aToB.over.chain Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,498 @@ +chain 21270171362 chr1 249250621 + 10000 249233096 chr1 247249719 + 0 247199719 2 +619 137 0 +166661 50000 50000 +40302 50000 50000 +153649 50000 50000 +1098479 1 1 +47 1 1 +73 117 114 +773 1 1 +43 1 1 +864369 2 2 +51 3 0 +104 13694 13694 +104 0 3 +51 2 2 +134936 50000 50000 +1161048 150000 60000 +1440092 27273 50000 +7590365 50000 50000 +116914 100000 50000 +237250 50000 50000 +3518496 50000 50000 +12702424 150000 50000 +16145012 0 1 +7772 1 0 +4705841 0 1 +52977198 50000 50000 +157344 21065 50000 +16604841 50000 50000 +189539 150000 50000 +398739 21050000 20290000 +195588 50000 50000 +186739 150000 50000 +175055 50000 50000 +201709 100000 50000 +126477 130183 50000 +381 0 3 +315 0 2 +62 1 1 +45 1 0 +19 0 1 +8 1 1 +1158 1 0 +314 12 13 +2849 3 0 +5615 1 1 +37 1 1 +3172 6 4 +190 1 1 +34 1 1 +380 0 1 +2099 3 0 +765 2 2 +366 0 4 +1186 1 0 +460 0 1 +1242 28 28 +574 1 1 +21 1 1 +1460 1 1 +105 1 1 +701 3 0 +239 0 1 +970 11 11 +2365 1 1 +21 1 1 +384 8 8 +996 2 0 +10383 2 0 +713 0 1 +5188 1 1 +30 1 1 +1233 1 0 +132 1 1 +44 1 1 +1123 22 22 +1810 1 0 +512 1 1 +39 1 1 +1096 0 16 +743 1 0 +9028 0 1 +2506 0 6 +8446 2 0 +5505 0 3 +7541 1 0 +109864 50000 50000 +78698 50000 50000 +127263 50000 50000 +170669 50000 50000 +38311 100000 100000 +1022394 50000 50000 +281532 289973 50000 +1648 1539 0 +76 3225 3 +1018 34 34 +1716 2 0 +159 4 0 +1600 0 6 +1385 1 0 +2066 1 1 +32 1 3 +1556908 150000 50000 +185320 150000 50000 +172789 50000 50000 +220313 50000 50000 +455185 50000 50000 +22047237 1 0 +34365824 150000 50000 +259514 150000 50000 +17265625 50000 50000 +11394365 50000 50000 +13665999 150000 50000 +174886 + +chain 22466185064 chr2 243199373 + 10000 243102476 chr2 242951149 + 0 242751149 1 +1201236 0 1 +2057 1 1 +26 1 1 +4043 22 0 +82 7 101 +33 84 0 +26 1 23 +67 48 0 +176 318 0 +40 92 0 +33 0 74 +62 0 6 +22 0 118 +387 2446 0 +843 2450 0 +167 2304 0 +21342 1 1 +50 4 0 +2040 0 4 +9053 2 0 +88 3 53 +1078 0 1 +4122 1 0 +1608 28 1 +4029 0 9 +967 4547 1000 +420 27 0 +2237126 0 1 +2458 17 17 +4595 4 0 +3531 14 14 +3954 51129 50000 +1426129 160449 100025 +11087286 0 3 +773 103977 50000 +1576 0 1 +240 0 1 +318 2 0 +255 0 16 +2851 10 10 +1404 1 1 +27 1 1 +703 13 0 +375 0 1 +4783388 35000 25000 +848 0 2 +1225 0 2 +391 1 0 +3653 1 1 +28 1 1 +49 0 4 +4514 0 9 +9628 1 9 +1483 7 7 +1990 0 1 +1949 1 0 +2716230 1 0 +7799848 851 851 +38932068 5 9 +9477928 0 3 +7529698 72396 0 +1891551 294073 150000 +17672 1 0 +5792 1 0 +9017 0 266 +2944 0 1 +9388 2 0 +37828 4 0 +23436 0 4 +290931 1273578 1000000 +731068 3000000 3000000 +2558421 0 1 +1197 10 0 +685 42 46 +2309 0 1 +1332 22 23 +344 0 1 +1645 4 4 +4093 25 25 +2446 1 0 +6329 1 0 +769 0 1 +873 7 0 +1299 0 1 +8250 15 15 +4291 10626 12548 +1063 103 0 +75 0 218 +5897 1 1 +33 1 1 +9905 51 37 +1711 1 1 +45 1 1 +1597 4 4 +61 1 1 +869 13 0 +1633 15 15 +1179 3 0 +2819 0 2 +156 88 465 +100 0 25 +4753 0 8 +4903 6 6 +3847 0 2 +108126 0 145 +3542 1 0 +10276 0 1 +402 1 1 +47 1 1 +63 2 0 +583 1 1 +34 1 1 +8974 0 46 +379 1 1 +70 1 1 +2474 0 102 +1756 0 1 +8426 0 1 +11986570 151150 142000 +14207 1 1 +49 1 1 +1781 0 12 +409 1 0 +1874 1 1 +33 1 1 +4795 2 0 +3686 1 1 +15 1 1 +164 2 0 +7287 5 5 +702023 72796 150000 +69 1 0 +1598 0 1 +1340 0 1 +1030 0 4 +1166 10 10 +6406 1 1 +34 1 1 +3283 2 4 +496 1 23 +25 10 0 +40 1 1 +21282 2 1 +1406 0 44 +937 17 0 +18255 1 0 +172366 0 281526 +40517 0 406 +58864 1 2 +1843 0 2 +14994 0 1 +12992 2 0 +2571146 1 0 +35688061 108224 100000 +29671719 1 0 +39665349 1 0 +14876089 64197 20000 +401 0 3 +1831 1 1 +61 1 1 +654 11 1 +127 0 28 +116 25 29 +74 9 9 +3247 2 0 +1355 1 0 +816 1 0 +21 3 0 +526 1 1 +60 1 1 +773 1 0 +1494 1 0 +1683 1 0 +21 1 1 +596 1 0 +1582 1 0 +425 0 3 +1139 0 8 +138 144 813 +71 1 0 +385638 1 1 +219 1 1 +51 7 7 +54 15205 15205 +54 7 7 +51 1 1 +110 1 1 +5198249 0 1 +115 80 0 +60 40 0 +80 100 20 +442 1 1 +35 1 1 +119 9 129 +14 0 40 +61 1 1 +85 0 40 +1331 0 1 +1194 12 14 +1773 0 5 +1623 1 1 +25 1 1 +2422 21 22 +2315 0 1 +31 1 1 +1508 0 3 +50 0 4 +970 6 6 +7234 4 0 +1228 1 0 +1233 8 1 +4207 1 1 +41 1 1 +1715 50 50 +1532 0 2 +1714 2 0 +2299 2 0 +2143 1 1 +18 1 1 +917 1 0 +1082 1 1 +49 1 1 +9098 0 4 +5529 0 1 +3266 0 8 +894 6 0 +1440 1 1 +2095 2 0 +4179 18 13 +1785 0 1 +1674 0 6 +1217 32348 33000 +287 17 23 +40 173 0 +20 161 0 +13 66 0 +12 71 1 +12548 30000 30000 +952154 41011 25000 +1914 1 0 +225 1 1 +57 1 1 +2910 0 1 +471 1 0 +1956 1 1 +43 1 1 +991 0 92 +2863 3 0 +1838 306 0 +1006 30 0 +206 1 1 +27 0 3 +221 17 17 +1525 8 0 +413 1 1 +32 2 2 +1573 12 12 +2258676 + +chain 18404394637 chr3 198022430 + 60000 197962430 chr3 199501827 + 35000 199446827 3 +13552792 0 1 +585083 0 1 +2092 1 2 +71 0 1 +31067262 0 1 +90 1 0 +5628461 0 15 +788 1 0 +3676 0 2 +35 1 1 +4682 1 0 +1295 0 5 +437 53 42 +326 0 2 +3309 1 1 +40 1 1 +998 0 3 +3584 5 0 +930 5 7 +845 1 1 +28 2 1 +303 0 1 +507 0 5 +5088 1 0 +2185 10046 10048 +949 4 4 +35 1 1 +2874 0 1 +6717 0 1 +2823 1 0 +703 0 4 +5143 1 0 +2490 10 10 +162 7 7 +6308 0 15 +15177535 152352 260003 +2532 1 0 +1633 2 2 +24207544 3000000 4400000 +60453436 0 4 +40076813 20999 20000 +8195 1 1 +44 1 1 +1408 1 1 +33 1 1 +172 3 4 +25 1 1 +538 13 13 +173 1 1 +27 1 1 +636 1 1 +28 1 1 +470 3 3 +112 1 1 +375 1 1 +26 26 0 +115 78 0 +52 23 0 +104 26 0 +15 231 0 +56 1 1 +20 1 1 +815 16 16 +484 1 1 +49 18 0 +509 4 3 +23 1 1 +391 1 1 +44 1 1 +1278 0 4 +32 1 1 +263 4 0 +27 1 1 +2416 0 2 +3184 43 43 +1150 13 13 +736 1 1 +47 1 1 +1416 1 1 +20 1 1 +1020 1 1 +25 1 1 +482 5 0 +716 1 0 +1697 1 1 +29 1 1 +1270261 23108 27000 +40930 1 0 +17455 1 1 +28 4 4 +43 0 491 +1679 1 1 +33 7 5 +29 1 3 +54863 53 16 +7653 2 2 +29 2 2 +15 0 30 +180 0 75 +215 45 0 +360 915 0 +6188 96 0 +17 288 0 +1388 1 1 +37 1 1 +7956 0 1 +374 0 1 +2442058 + +chain 310844 chr4 191154276 + 9241835 9252105 chr4 191273063 + 8941714 8947231 850 +2726 14 14 +243 9 9 +78 4 4 +157 213 211 +265 85 85 +524 4751 0 +379 283 283 +539 + +chain 9105 chr4 191154276 + 8982741 8983189 chr10 135374737 - 120304868 120305301 22041837 +59 380 365 +9 diff -r 000000000000 -r 0d0d8d882315 test-data/test_bam_01_input_a.bam Binary file test-data/test_bam_01_input_a.bam has changed diff -r 000000000000 -r 0d0d8d882315 test-data/test_bam_01_input_a.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_bam_01_input_a.sam Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,27 @@ +@HD VN:1.0 SO:coordinate +@SQ SN:chr1 LN:1000051 +@SQ SN:chr2 LN:1000051 +@SQ SN:chr3 LN:1000051 +@SQ SN:chr4 LN:9250051 +@PG ID:- VN:1.0.0 CL:cmatrix +@CO Test data for CrossMap bam +read_001 0 chr1 100000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_002 0 chr2 100000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_003 0 chr3 100000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_004 0 chr4 9200000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_005 0 chr4 8940000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_006 0 chr1 1000000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_007 0 chr2 1000000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_008 0 chr3 1000000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_009 0 chr4 9250000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_010 0 chr4 9000000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_011 16 chr1 100000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_012 16 chr2 100000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_013 16 chr3 100000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_014 16 chr4 9200000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_015 16 chr4 8940000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_016 16 chr1 1000000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_017 16 chr2 1000000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_018 16 chr3 1000000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_019 16 chr4 9250000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * +read_020 16 chr4 9000000 60 50M * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN * diff -r 000000000000 -r 0d0d8d882315 test-data/test_bam_01_output_a.bam Binary file test-data/test_bam_01_output_a.bam has changed diff -r 000000000000 -r 0d0d8d882315 test-data/test_bam_01_output_a.unmap.bam Binary file test-data/test_bam_01_output_a.unmap.bam has changed diff -r 000000000000 -r 0d0d8d882315 test-data/test_bam_01_output_b.bam Binary file test-data/test_bam_01_output_b.bam has changed diff -r 000000000000 -r 0d0d8d882315 test-data/test_bam_01_output_b.unmap.bam Binary file test-data/test_bam_01_output_b.unmap.bam has changed diff -r 000000000000 -r 0d0d8d882315 test-data/test_bed_01_input_a.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_bed_01_input_a.bed Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,5 @@ +chr1 100000 1000000 +chr2 100000 1000000 +chr3 100000 1000000 +chr4 9200000 9250000 +chr4 8940000 9000000 diff -r 000000000000 -r 0d0d8d882315 test-data/test_bed_01_output_a__all.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_bed_01_output_a__all.bed Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,14 @@ +chr1 100000 1000000 (split.1:chr1:100000:177417:+) chr1 89863 167280 +chr1 100000 1000000 (split.2:chr1:227417:267719:+) chr1 217280 257582 +chr1 100000 1000000 (split.3:chr1:317719:471368:+) chr1 307582 461231 +chr1 100000 1000000 (split.4:chr1:521368:1000000:+) chr1 511231 989863 +chr2 100000 1000000 -> chr2 90000 990000 +chr3 100000 1000000 -> chr3 75000 975000 +chr4 9200000 9250000 (split.1:chr4:9241835:9244561:+) chr4 8941714 8944440 +chr4 9200000 9250000 (split.2:chr4:9244575:9244818:+) chr4 8944454 8944697 +chr4 9200000 9250000 (split.3:chr4:9244827:9244905:+) chr4 8944706 8944784 +chr4 9200000 9250000 (split.4:chr4:9244909:9245066:+) chr4 8944788 8944945 +chr4 9200000 9250000 (split.5:chr4:9245279:9245544:+) chr4 8945156 8945421 +chr4 9200000 9250000 (split.6:chr4:9245629:9246153:+) chr4 8945506 8946030 +chr4 8940000 9000000 (split.1:chr4:8982741:8982800:+) chr10 15069810 15069869 +chr4 8940000 9000000 (split.2:chr4:8983180:8983189:+) chr10 15069436 15069445 diff -r 000000000000 -r 0d0d8d882315 test-data/test_bed_01_output_a__only-matches.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_bed_01_output_a__only-matches.bed Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,14 @@ +chr1 89863 167280 +chr1 217280 257582 +chr1 307582 461231 +chr1 511231 989863 +chr2 90000 990000 +chr3 75000 975000 +chr4 8941714 8944440 +chr4 8944454 8944697 +chr4 8944706 8944784 +chr4 8944788 8944945 +chr4 8945156 8945421 +chr4 8945506 8946030 +chr10 15069810 15069869 +chr10 15069436 15069445 diff -r 000000000000 -r 0d0d8d882315 test-data/test_bed_02_input_a.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_bed_02_input_a.bed Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,5 @@ +chr1 100 10000 +chr2 100 10000 +chr3 100 10000 +chr4 8941700 8947200 +chr5 1 100000000 \ No newline at end of file diff -r 000000000000 -r 0d0d8d882315 test-data/test_bed_02_output_a__all.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_bed_02_output_a__all.bed Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,5 @@ +chr1 100 10000 Fail +chr2 100 10000 Fail +chr3 100 10000 Fail +chr4 8941700 8947200 Fail +chr5 1 100000000 Fail diff -r 000000000000 -r 0d0d8d882315 test-data/test_bed_02_output_a__only-matches.bed diff -r 000000000000 -r 0d0d8d882315 test-data/test_bigwig_01_input_a.bw Binary file test-data/test_bigwig_01_input_a.bw has changed diff -r 000000000000 -r 0d0d8d882315 test-data/test_bigwig_01_output_a.bw Binary file test-data/test_bigwig_01_output_a.bw has changed diff -r 000000000000 -r 0d0d8d882315 test-data/test_bigwig_01_output_a.sorted.bgr Binary file test-data/test_bigwig_01_output_a.sorted.bgr has changed diff -r 000000000000 -r 0d0d8d882315 test-data/test_gff_01_input_a.gtf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_gff_01_input_a.gtf Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,5 @@ +chr1 CrossMap_test_data CDS 100000 1000000 0.000000 - 0 gene_id "TEST_GENE_1"; +chr2 CrossMap_test_data CDS 100000 1000000 0.000000 - 0 gene_id "TEST_GENE_1"; +chr3 CrossMap_test_data CDS 100000 1000000 0.000000 - 0 gene_id "TEST_GENE_1"; +chr4 CrossMap_test_data CDS 9200000 9250000 0.000000 - 0 gene_id "TEST_GENE_1"; +chr5 CrossMap_test_data CDS 8940000 9000000 0.000000 - 0 gene_id "TEST_GENE_1"; diff -r 000000000000 -r 0d0d8d882315 test-data/test_gff_01_output_a__all.gtf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_gff_01_output_a__all.gtf Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,5 @@ +chr1 CrossMap_test_data CDS 100000 1000000 0.000000 - 0 gene_id "TEST_GENE_1"; fail (multpile match to target assembly) +chr2 CrossMap_test_data CDS 100000 1000000 0.000000 - 0 gene_id "TEST_GENE_1"; -> chr2 CrossMap_test_data CDS 90000 990000 0.000000 - 0 gene_id "TEST_GENE_1"; +chr3 CrossMap_test_data CDS 100000 1000000 0.000000 - 0 gene_id "TEST_GENE_1"; -> chr3 CrossMap_test_data CDS 75000 975000 0.000000 - 0 gene_id "TEST_GENE_1"; +chr4 CrossMap_test_data CDS 9200000 9250000 0.000000 - 0 gene_id "TEST_GENE_1"; fail (multpile match to target assembly) +chr5 CrossMap_test_data CDS 8940000 9000000 0.000000 - 0 gene_id "TEST_GENE_1"; fail (no match to target assembly) diff -r 000000000000 -r 0d0d8d882315 test-data/test_gff_01_output_a__only-matches.gtf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_gff_01_output_a__only-matches.gtf Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,2 @@ +chr2 CrossMap_test_data CDS 90000 990000 0.000000 - 0 gene_id "TEST_GENE_1"; +chr3 CrossMap_test_data CDS 75000 975000 0.000000 - 0 gene_id "TEST_GENE_1"; diff -r 000000000000 -r 0d0d8d882315 test-data/test_vcf_01.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_vcf_01.fasta Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,10 @@ +>chr1 +CAAAAAAGCAGTTGACAGTTGTTCGGGCTTGTTACGCATCTTAAGATCGAATAAGGAGAGAGGGTCTAAACG +AGGCGCACCCCGCCTATGGGTGATCGAGGTACTAGGGGTTGGTCGCAGGTCTGTATTACCGTTAGCGGTGCA +AGGGGATCTGATCGAGTGATTCACCTACTCATGTGGCGAGCACGCCGACGAAATACTCCTGGTCGTGTTATA +AAGCCCTGGTTTTCCTTTCC +>chr2 +CACAAAATGCACGTGGATGCAGGCATTTATCCAACCCACACTATTACGTTCACCAAATGTGTGGACCAACTG +CGGGACTAGGTAAGCTTGTCCTCAATGAGCGAAATTGATATTTCTCTACCGACTTGGGGTCGACTGGACGAG +TCAGCTGTGCAACAGCTCAGCCGGTTTCGATAAACCGAAACCTTGAATGTTTGGACTTGCGTCATGGCGAAC +AAAGATCGTTCATGTCGCA \ No newline at end of file diff -r 000000000000 -r 0d0d8d882315 test-data/test_vcf_01.over.chain --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_vcf_01.over.chain Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,11 @@ +chain 4900 chr1 236 + 1 236 chr2 236 - 1 237 1 + 9 1 0 + 10 0 5 + 61 4 0 + 16 0 4 + 42 3 0 + 16 0 8 + 14 1 0 + 3 7 0 + 48 + diff -r 000000000000 -r 0d0d8d882315 test-data/test_vcf_01_input.vcf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_vcf_01_input.vcf Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,8 @@ +##fileformat=VCFv4.2 +##FORMAT= +##FORMAT= +##FORMAT= +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SAMP001 SAMP002 +1 10 rs11449 G A . PASS . GT 0/0 0/1 +1 100 rs84825 C C . PASS . GT:GP 0/1:. 0/1:0.03,0.97,0 +1 200 rs84823 T G . PASS . GT:PL ./.:. 1/1:10,5,0 diff -r 000000000000 -r 0d0d8d882315 test-data/test_vcf_01_output.vcf.unmap --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_vcf_01_output.vcf.unmap Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,5 @@ +##fileformat=VCFv4.2 +##FORMAT= +##FORMAT= +##FORMAT= +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SAMP001 SAMP002 diff -r 000000000000 -r 0d0d8d882315 test-data/test_wig_01_input_a.wig --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_wig_01_input_a.wig Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,10 @@ +variableStep chrom=chr1 span=900000 +100000 110 +variableStep chrom=chr2 span=900000 +100000 220 +variableStep chrom=chr3 span=900000 +100000 330 +variableStep chrom=chr4 span=50000 +9200000 400 +variableStep chrom=chr4 span=60000 +8940000 450 diff -r 000000000000 -r 0d0d8d882315 test-data/test_wig_01_output_a.bw Binary file test-data/test_wig_01_output_a.bw has changed diff -r 000000000000 -r 0d0d8d882315 test-data/test_wig_01_output_a.sorted.bgr --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_wig_01_output_a.sorted.bgr Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,2 @@ +chr2 89999 989999 220.0 +chr3 74999 974999 330.0 diff -r 000000000000 -r 0d0d8d882315 tool-data/all_fasta.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/all_fasta.loc.sample Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,18 @@ +#This file lists the locations and dbkeys of all the fasta files +#under the "genome" directory (a directory that contains a directory +#for each build). The script extract_fasta.py will generate the file +#all_fasta.loc. This file has the format (white space characters are +#TAB characters): +# +# +# +#So, all_fasta.loc could look something like this: +# +#apiMel3 apiMel3 Honeybee (Apis mellifera): apiMel3 /path/to/genome/apiMel3/apiMel3.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /path/to/genome/hg19/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /path/to/genome/hg19/hg19full.fa +# +#Your all_fasta.loc file should contain an entry for each individual +#fasta file. So there will be multiple fasta files for each build, +#such as with hg19 above. +# diff -r 000000000000 -r 0d0d8d882315 tool-data/liftOver.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/liftOver.loc.sample Sat Jul 01 17:46:16 2017 -0400 @@ -0,0 +1,27 @@ +#This is a sample file distributed with Galaxy that is used by the +#liftOver tools. The liftOver.loc file has this format (white space +#characters are TAB characters): +# +# +# +#So, for example, if you had the chain file to convert from anoCar1 to galGal3 +#located at /depot/data2/galaxy/anoCar1/liftOver/anoCar1ToGalGal3.over.chain, +#then the liftOver.loc entry would look like this: +# +#anoCar1 galGal3 /depot/data2/galaxy/anoCar1/liftOver/anoCar1ToGalGal3.over.chain +# +#and your /depot/data2/galaxy/anoCar1/liftOver directory would +#contain all of your "chain" files (e.g.): +# +#-rw-rw-r-- 1 gua110 galaxy 24046079 2008-01-16 14:20 anoCar1ToGalGal3.over.chain +#-rw-rw-r-- 1 gua110 galaxy 13216668 2008-01-16 14:20 anoCar1ToGasAcu1.over.chain +#-rw-rw-r-- 1 gua110 galaxy 29597067 2008-01-16 14:20 anoCar1ToHg18.over.chain +#...etc... +# +#Your liftOver.loc file should include an entry per line for each build you can +#convert. For example: +# +#anoCar1 galGal3 /depot/data2/galaxy/anoCar1/liftOver/anoCar1ToGalGal3.over.chain +#anoCar1 gasAcu1 /depot/data2/galaxy/anoCar1/liftOver/anoCar1ToGasAcu1.over.chain +#anoCar1 hg18 /depot/data2/galaxy/anoCar1/liftOver/anoCar1ToHg18.over.chain +#...etc...