Mercurial > repos > iuc > cialign
comparison cialign.xml @ 0:9dce901753b9 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/cialign commit bab03e73ec98fc53e8c0eb899ab8144a775d331a
| author | iuc |
|---|---|
| date | Mon, 02 Mar 2026 15:36:38 +0000 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| -1:000000000000 | 0:9dce901753b9 |
|---|---|
| 1 <tool id="cialign" name="CIAlign" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="25.0"> | |
| 2 <description>clean, visualise and analyse a multiple sequence alignment</description> | |
| 3 <macros> | |
| 4 <import>macros.xml</import> | |
| 5 </macros> | |
| 6 <expand macro="requirements"/> | |
| 7 <version_command>CIAlign --version</version_command> | |
| 8 <command detect_errors="exit_code"><![CDATA[ | |
| 9 #if str($input.extension) == "fasta.gz": | |
| 10 gunzip -c '$input' > input.fasta && | |
| 11 CIAlign --infile input.fasta | |
| 12 #else: | |
| 13 CIAlign --infile '$input' | |
| 14 #end if | |
| 15 --outfile_stem 'output' | |
| 16 | |
| 17 ###### Basic Options | |
| 18 $basic_options.all | |
| 19 $basic_options.clean | |
| 20 $basic_options.visualise | |
| 21 $basic_options.interpret | |
| 22 | |
| 23 ###### Cleaning Options | |
| 24 ### Remove Divergent options | |
| 25 #if str($cleaning_options.remove_divergent_cond.remove_divergent_param) == "true": | |
| 26 --remove_divergent | |
| 27 --remove_divergent_minperc $cleaning_options.remove_divergent_cond.remove_divergent_minperc | |
| 28 #for $s in $cleaning_options.remove_divergent_cond.remove_divergent_retain_seqs | |
| 29 --remove_divergent_retain '$s.remove_divergent_retain' | |
| 30 #end for | |
| 31 #for $s in $cleaning_options.remove_divergent_cond.remove_divergent_retain_strings | |
| 32 --remove_divergent_retain_str '$s.remove_divergent_retain_str' | |
| 33 #end for | |
| 34 #end if | |
| 35 | |
| 36 ### Remove Insertions options | |
| 37 #if str($cleaning_options.remove_insertions_cond.remove_insertions_param) == "true": | |
| 38 --remove_insertions | |
| 39 --insertion_min_size $cleaning_options.remove_insertions_cond.insertion_min_size | |
| 40 --insertion_max_size $cleaning_options.remove_insertions_cond.insertion_max_size | |
| 41 --insertion_min_flank $cleaning_options.remove_insertions_cond.insertion_min_flank | |
| 42 --insertion_min_perc $cleaning_options.remove_insertions_cond.insertion_min_perc | |
| 43 #end if | |
| 44 | |
| 45 ### Crop Ends options | |
| 46 #if str($cleaning_options.crop_ends_cond.crop_ends_param) == "true": | |
| 47 --crop_ends | |
| 48 --crop_ends_mingap_perc $cleaning_options.crop_ends_cond.crop_ends_mingap_perc | |
| 49 --crop_ends_redefine_perc $cleaning_options.crop_ends_cond.crop_ends_redefine_perc | |
| 50 #for $s in $cleaning_options.crop_ends_cond.crop_ends_retain_seqs | |
| 51 --crop_ends_retain '$s.crop_ends_retain' | |
| 52 #end for | |
| 53 #for $s in $cleaning_options.crop_ends_cond.crop_ends_retain_strings | |
| 54 --crop_ends_retain_str '$s.crop_ends_retain_str' | |
| 55 #end for | |
| 56 #end if | |
| 57 | |
| 58 ### Remove Short options | |
| 59 #if str($cleaning_options.remove_short_cond.remove_short_param) == "true": | |
| 60 --remove_short | |
| 61 --remove_min_length $cleaning_options.remove_short_cond.remove_min_length | |
| 62 #for $s in $cleaning_options.remove_short_cond.remove_short_retain_seqs | |
| 63 --remove_short_retain '$s.remove_short_retain' | |
| 64 #end for | |
| 65 #for $s in $cleaning_options.remove_short_cond.remove_short_retain_strings | |
| 66 --remove_short_retain_str '$s.remove_short_retain_str' | |
| 67 #end for | |
| 68 #end if | |
| 69 | |
| 70 ### Crop Divergent options | |
| 71 #if str($cleaning_options.crop_divergent_cond.crop_divergent_param) == "true": | |
| 72 --crop_divergent | |
| 73 --crop_divergent_min_prop_ident $cleaning_options.crop_divergent_cond.crop_divergent_min_prop_ident | |
| 74 --crop_divergent_min_prop_nongap $cleaning_options.crop_divergent_cond.crop_divergent_min_prop_nongap | |
| 75 --crop_divergent_buffer_size $cleaning_options.crop_divergent_cond.crop_divergent_buffer_size | |
| 76 #end if | |
| 77 | |
| 78 ### Retain options | |
| 79 #if str($cleaning_options.retain_cond.retain_param) == "true": | |
| 80 #for $s in $cleaning_options.retain_cond.retain_seqs | |
| 81 --retain '$s.retain' | |
| 82 #end for | |
| 83 #for $s in $cleaning_options.retain_cond.retain_strings | |
| 84 --retain_str '$s.retain_str' | |
| 85 #end for | |
| 86 #end if | |
| 87 | |
| 88 ### Keep Gap only | |
| 89 $cleaning_options.keep_gaponly | |
| 90 | |
| 91 ###### Visualisation Options | |
| 92 ### basic visualisation options | |
| 93 $visualisation_options.basic_visualisation_options.plot_input | |
| 94 $visualisation_options.basic_visualisation_options.plot_output | |
| 95 $visualisation_options.basic_visualisation_options.plot_markup | |
| 96 $visualisation_options.basic_visualisation_options.plot_consensus_identity | |
| 97 $visualisation_options.basic_visualisation_options.plot_consensus_similarity | |
| 98 #if str($visualisation_options.output_settings_cond.output_settings_param) == "true": | |
| 99 --plot_width $visualisation_options.basic_visualisation_options.output_settings_cond.plot_width | |
| 100 --plot_height $visualisation_options.basic_visualisation_options.output_settings_cond.plot_height | |
| 101 --plot_dpi $visualisation_options.basic_visualisation_options.output_settings_cond.plot_dpi | |
| 102 $visualisation_options.basic_visualisation_options.output_settings_cond.plot_keep_numbers | |
| 103 $visualisation_options.basic_visualisation_options.output_settings_cond.plot_force_numbers | |
| 104 --plot_identity_palette '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_identity_palette' | |
| 105 --plot_identity_gap_col '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_identity_gap_col' | |
| 106 --plot_similarity_palette '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_similarity_palette' | |
| 107 --plot_similarity_gap_col '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_similarity_gap_col' | |
| 108 --plot_sub_matrix_name '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_sub_matrix_name' | |
| 109 --palette '$visualisation_options.basic_visualisation_options.output_settings_cond.palette' | |
| 110 #end if | |
| 111 | |
| 112 ### Sequence logos | |
| 113 #if str($visualisation_options.sequence_logo_cond.sequence_logo_param) == "true": | |
| 114 --make_sequence_logo | |
| 115 --sequence_logo_type "$visualisation_options.sequence_logo_cond.sequence_logo_type" | |
| 116 --sequence_logo_dpi $visualisation_options.sequence_logo_cond.sequence_logo_dpi | |
| 117 --sequence_logo_font '$visualisation_options.sequence_logo_cond.sequence_logo_font' | |
| 118 --sequence_logo_nt_per_row $visualisation_options.sequence_logo_cond.sequence_logo_nt_per_row | |
| 119 #if $visualisation_options.sequence_logo_cond.logo_start: | |
| 120 --logo_start $visualisation_options.sequence_logo_cond.logo_start | |
| 121 #end if | |
| 122 #if $visualisation_options.sequence_logo_cond.logo_end: | |
| 123 --logo_end $visualisation_options.sequence_logo_cond.logo_end | |
| 124 #end if | |
| 125 #end if | |
| 126 | |
| 127 ### Statistics Plots | |
| 128 $visualisation_options.statistics_plots.plot_stats_input | |
| 129 $visualisation_options.statistics_plots.plot_stats_output | |
| 130 #if $visualisation_options.statistics_plots.plot_stats_input or $visualisation_options.statistics_plots.plot_stats_output | |
| 131 --plot_stats_dpi $visualisation_options.statistics_plots.stats_settings.plot_stats_dpi | |
| 132 --plot_stats_height $visualisation_options.statistics_plots.stats_settings.plot_stats_width | |
| 133 --plot_stats_width $visualisation_options.statistics_plots.stats_settings.plot_stats_height | |
| 134 --plot_stats_colour '$visualisation_options.statistics_plots.stats_settings.plot_stats_colour' | |
| 135 #end if | |
| 136 | |
| 137 ###### Interpretation Functions | |
| 138 ### consensus sequences | |
| 139 #if str($interpretation_options.consensus_sequences_cond.consensus_sequences_param) == "true": | |
| 140 --make_consensus | |
| 141 --consensus_type '$interpretation_options.consensus_sequences_cond.consensus_type' | |
| 142 $interpretation_options.consensus_sequences_cond.consensus_keep_gaps | |
| 143 #end if | |
| 144 | |
| 145 ### Position Matrices | |
| 146 $interpretation_options.position_matrices.pwm_input | |
| 147 $interpretation_options.position_matrices.pwm_output | |
| 148 #if $interpretation_options.position_matrices.matrices_settings.pwm_start: | |
| 149 --pwm_start $interpretation_options.position_matrices.matrices_settings.pwm_start | |
| 150 #end if | |
| 151 #if $interpretation_options.position_matrices.matrices_settings.pwm_end: | |
| 152 --pwm_end $interpretation_options.position_matrices.matrices_settings.pwm_end | |
| 153 #end if | |
| 154 #if $interpretation_options.position_matrices.pwm_input or $interpretation_options.position_matrices.pwm_output: | |
| 155 --pwm_freqtype '$interpretation_options.position_matrices.matrices_settings.pwm_freqtype' | |
| 156 --pwm_alphatype '$interpretation_options.position_matrices.matrices_settings.pwm_alphatype' | |
| 157 --pwm_alphaval $interpretation_options.position_matrices.matrices_settings.pwm_alphaval | |
| 158 #end if | |
| 159 $interpretation_options.position_matrices.pwm_output_blamm | |
| 160 $interpretation_options.position_matrices.pwm_output_meme | |
| 161 | |
| 162 ### Similarity Matrices | |
| 163 $interpretation_options.similarity_matrices.make_similarity_matrix_input | |
| 164 $interpretation_options.similarity_matrices.make_similarity_matrix_output | |
| 165 #if $interpretation_options.similarity_matrices.make_similarity_matrix_input or $interpretation_options.similarity_matrices.make_similarity_matrix_output: | |
| 166 --make_simmatrix_keepgaps $interpretation_options.similarity_matrices.similarity_matrices_settings.make_simmatrix_keepgaps | |
| 167 --make_simmatrix_dp $interpretation_options.similarity_matrices.similarity_matrices_settings.make_simmatrix_dp | |
| 168 --make_simmatrix_minoverlap $interpretation_options.similarity_matrices.similarity_matrices_settings.make_simmatrix_minoverlap | |
| 169 #end if | |
| 170 | |
| 171 | |
| 172 ###### Editing Functions | |
| 173 #if str($editing_functions.get_section_cond.get_section_param) == "true": | |
| 174 --get_section | |
| 175 --section_start $editing_functions.get_section_cond.section_start | |
| 176 --section_end $editing_functions.get_section_cond.section_end | |
| 177 #end if | |
| 178 $editing_functions.replace_input_tu | |
| 179 $editing_functions.replace_input_ut | |
| 180 $editing_functions.replace_output_tu | |
| 181 $editing_functions.replace_output_ut | |
| 182 ### Unaligning | |
| 183 $editing_functions.unalign_input | |
| 184 $editing_functions.unalign_output | |
| 185 ### Removing Duplicates | |
| 186 $editing_functions.deduplicate_ids | |
| 187 #if str($editing_functions.deduplicate_ids) | |
| 188 --duporder '$editing_functions.duporder' | |
| 189 #end if | |
| 190 ]]></command> | |
| 191 <inputs> | |
| 192 <param name="input" type="data" format="fasta,fasta.gz" label="Input FASTA" help="Upload a multiple sequence alignment in FASTA or compressed FASTA (.gz) format."/> <!-- BASIC options --> | |
| 193 <section name="basic_options" title="Basic Options" expanded="yes"> | |
| 194 <param argument="--all" type="boolean" truevalue="--all" falsevalue="" checked="false" label="Use All Functions" help="Enable all available functions with default parameters unless overridden."/> | |
| 195 <param argument="--clean" type="boolean" truevalue="--clean" falsevalue="" checked="false" label="Use All Cleaning Functions" help="Use all available cleaning functions with default parameters unless overridden."/> | |
| 196 <param argument="--visualise" type="boolean" truevalue="--visualise" falsevalue="" checked="false" label="Use All Visualisation Functions" help="Use all available mini alignment visualisation functions with default parameters unless overridden."/> | |
| 197 <param argument="--interpret" type="boolean" truevalue="--interpret" falsevalue="" checked="false" label="Use All Interpretation Functions" help="Use all available interpretation functions with default parameters unless overridden."/> | |
| 198 <param name="log_out" type="boolean" checked="false" label="Output log file" help="Outputs the log file."/> | |
| 199 </section> | |
| 200 | |
| 201 <section name="cleaning_options" title="Cleaning Options" expanded="false"> | |
| 202 <!-- Remove divergent options --> | |
| 203 <conditional name="remove_divergent_cond"> | |
| 204 <param name="remove_divergent_param" type="select" label="Remove divergent" help="Remove sequences with identity below a specified proportion of conserved positions."> | |
| 205 <option value="true">Yes</option> | |
| 206 <option value="false" selected="true">No</option> | |
| 207 </param> | |
| 208 <when value="true"> | |
| 209 <param argument="--remove_divergent_minperc" type="float" value="0.65" min="0" max="1" label="Minimum Identity Proportion" help="Minimum proportion of positions that must match the most common base or amino acid for a sequence to be kept."/> | |
| 210 <repeat name="remove_divergent_retain_seqs" title="sequences to retain" min="0"> | |
| 211 <param argument="--remove_divergent_retain" type="text" value="" label="Retain Sequence by Name" help="Always keep the sequence with this exact name. (must match a seq name)"> | |
| 212 <validator type="empty_field"/> | |
| 213 </param> | |
| 214 </repeat> | |
| 215 <repeat name="remove_divergent_retain_strings" title="strings to retain" min="0"> | |
| 216 <param argument="--remove_divergent_retain_str" type="text" value="" label="Retain Sequences Containing Text" help="Always keep sequences whose names contain this text."> | |
| 217 <validator type="empty_field"/> | |
| 218 </param> | |
| 219 </repeat> | |
| 220 </when> | |
| 221 <when value="false"/> | |
| 222 </conditional> | |
| 223 | |
| 224 <!-- Remove Insertions options --> | |
| 225 <conditional name="remove_insertions_cond"> | |
| 226 <param name="remove_insertions_param" type="select" label="Remove Rare Insertions" help="Remove insertions not present in the majority of sequences."> | |
| 227 <option value="true">Yes</option> | |
| 228 <option value="false" selected="true">No</option> | |
| 229 </param> | |
| 230 <when value="true"> | |
| 231 <param argument="--insertion_min_size" type="integer" value="3" min="1" label="Minimum Insertion Size" help="Only remove insertions larger than this number of residues. Must be less than or equal to the number of columns in your alignment."/> | |
| 232 <param argument="--insertion_max_size" type="integer" value="200" min="1" max="10000" label="Maximum Insertion Size" help="Only remove insertions smaller than this number of residues."/> | |
| 233 <param argument="--insertion_min_flank" type="integer" value="5" min="0" label="Minimum Flank Size" help="Minimum number of bases required on each side of an insertion. Must be less than half the alignment length."/> | |
| 234 <param argument="--insertion_min_perc" type="float" value="0.5" min="0" max="1" label="Minimum Presence Proportion" help="Remove insertions found in less than this proportion of sequences."/> | |
| 235 </when> | |
| 236 <when value="false"/> | |
| 237 </conditional> | |
| 238 | |
| 239 <!-- Crop Ends options --> | |
| 240 <conditional name="crop_ends_cond"> | |
| 241 <param name="crop_ends_param" type="select" label="Crop Sequence Ends" help="Trim ends of sequences if they are poorly aligned."> | |
| 242 <option value="true">Yes</option> | |
| 243 <option value="false" selected="true">No</option> | |
| 244 </param> | |
| 245 <when value="true"> | |
| 246 <param argument="--crop_ends_mingap_perc" type="float" value="0.05" min="0" max="0.6" label="Minimum Gap Change Threshold" help="Minimum proportion of sequence length (excluding gaps) used to detect significant change in gap numbers."/> | |
| 247 <param argument="--crop_ends_redefine_perc" type="float" value="0.1" min="0" max="0.5" label="Region Proportion to Check" help="Proportion of the sequence (excluding gaps) checked at each end to redefine cropping boundaries."/> | |
| 248 <repeat name="crop_ends_retain_seqs" title="sequences to retain" min="0"> | |
| 249 <param argument="--crop_ends_retain" type="text" value="" label="Retain Sequence by Name" help="Do not crop the sequence with this exact name. (must match a seq name)"> | |
| 250 <validator type="empty_field"/> | |
| 251 </param> | |
| 252 </repeat> | |
| 253 <repeat name="crop_ends_retain_strings" title="strings to retain" min="0"> | |
| 254 <param argument="--crop_ends_retain_str" type="text" value="" label="Retain Sequences Containing Text" help="Do not crop sequences whose names contain this text. Case-sensitive."> | |
| 255 <validator type="empty_field"/> | |
| 256 </param> | |
| 257 </repeat> | |
| 258 </when> | |
| 259 <when value="false"/> | |
| 260 </conditional> | |
| 261 | |
| 262 <!-- Remove Short options --> | |
| 263 <conditional name="remove_short_cond"> | |
| 264 <param name="remove_short_param" type="select" label="Remove Short Sequences" help="Remove sequences shorter than a specified length (excluding gaps)."> | |
| 265 <option value="true">Yes</option> | |
| 266 <option value="false" selected="true">No</option> | |
| 267 </param> | |
| 268 <when value="true"> | |
| 269 <param argument="--remove_min_length" type="integer" value="50" min="0" label="Minimum Sequence Length" help="Remove sequences shorter than this length, excluding gaps."/> | |
| 270 <repeat name="remove_short_retain_seqs" title="sequences to retain" min="0"> | |
| 271 <param argument="--remove_short_retain" type="text" value="" label="Retain Sequences by Name" help="Do not remove the sequence with this exact name. (must match a seq name)"> | |
| 272 <validator type="empty_field"/> | |
| 273 </param> | |
| 274 </repeat> | |
| 275 <repeat name="remove_short_retain_strings" title="strings to retain" min="0"> | |
| 276 <param argument="--remove_short_retain_str" type="text" value="" label="Retain Sequences Containing Text" help="Do not remove sequences whose names contain this text. Case-sensitive."> | |
| 277 <validator type="empty_field"/> | |
| 278 </param> | |
| 279 </repeat> | |
| 280 </when> | |
| 281 <when value="false"/> | |
| 282 </conditional> | |
| 283 | |
| 284 <!-- Crop Divergent options --> | |
| 285 <conditional name="crop_divergent_cond"> | |
| 286 <param name="crop_divergent_param" type="select" label="Crop Divergent Sequences" help="Remove highly divergent regions to improve alignment quality by focusing on more conserved parts."> | |
| 287 <option value="true">Yes</option> | |
| 288 <option value="false" selected="true">No</option> | |
| 289 </param> | |
| 290 <when value="true"> | |
| 291 <param argument="--crop_divergent_min_prop_ident" type="float" value="0.5" min="0.01" max="1" label="Minimum Identity Proportion" help="Minimum proportion of sequences that must share the same residue in a column."/> | |
| 292 <param argument="--crop_divergent_min_prop_nongap" type="float" value="0.5" min="0.01" max="1" label="Minimum Non-Gap Proportion" help="Minimum proportion of sequences that must contain a non-gap residue in a column."/> | |
| 293 <param argument="--crop_divergent_buffer_size" type="integer" value="5" min="1" label="Buffer Size" help="Number of consecutive columns that must meet the identity and non-gap criteria to retain a region."/> | |
| 294 </when> | |
| 295 <when value="false"/> | |
| 296 </conditional> | |
| 297 | |
| 298 <!-- Retain options --> | |
| 299 <conditional name="retain_cond"> | |
| 300 <param name="retain_param" type="select" label="Retain Specific Sequences" help="Specify sequences that should not be edited or removed during row-wise functions."> | |
| 301 <option value="true">Yes</option> | |
| 302 <option value="false" selected="true">No</option> | |
| 303 </param> | |
| 304 <when value="true"> | |
| 305 <repeat name="retain_seqs" title="sequences to retain" min="0"> | |
| 306 <param argument="--retain" type="text" value="" label="Retain Sequence with this Name" help="Do not edit or remove the sequence with this exact name during row-wise functions. Can be used multiple times. (must match a seq name)"> | |
| 307 <validator type="empty_field"/> | |
| 308 </param> | |
| 309 </repeat> | |
| 310 <repeat name="retain_strings" title="strings to retain" min="0"> | |
| 311 <param argument="--retain_str" type="text" value="" label="Retain Sequences Containing this String" help="Do not edit or remove sequences with names containing this text. Case-sensitive."> | |
| 312 <validator type="empty_field"/> | |
| 313 </param> | |
| 314 </repeat> | |
| 315 </when> | |
| 316 <when value="false"/> | |
| 317 </conditional> | |
| 318 | |
| 319 <param argument="--keep_gaponly" type="boolean" truevalue="--keep_gaponly" falsevalue="" checked="false" label="Keep Gap-Only Columns" help=" Keep columns in the alignment that consist entirely of gaps."/> | |
| 320 </section> | |
| 321 | |
| 322 <section name="visualisation_options" title="Visualisation Options" expanded="false"> | |
| 323 <!-- Visualisation options --> | |
| 324 <section name="basic_visualisation_options" title="Basic Visualisation Options" expanded="false"> | |
| 325 <param argument="--plot_input" type="boolean" checked="false" falsevalue="" truevalue="--plot_input" label="Plot input alignment" help="Visualisation of the input alignment"/> | |
| 326 <param argument="--plot_output" type="boolean" checked="false" falsevalue="" truevalue="--plot_output" label="Plot output alignment" help="Visualisation of the cleaned output alignment"/> | |
| 327 <param argument="--plot_markup" type="boolean" checked="false" falsevalue="" truevalue="--plot_markup" label="Plot markup" help="Visualisation of the input alignment with deleted rows and columns marked"/> | |
| 328 <param argument="--plot_consensus_identity" type="boolean" checked="false" falsevalue="" truevalue="--plot_consensus_identity" label="Plot consensus identity" help="Plot a mini alignment showing positions which are identical to or differ from the consensus."/> | |
| 329 <param argument="--plot_consensus_similarity" type="boolean" checked="false" falsevalue="" truevalue="--plot_consensus_similarity" label="Plot consensus similarity" help="Plot a mini alignment showing positions based on their score when when compared via a substitution matrix to the consensus."/> | |
| 330 <conditional name="output_settings_cond"> | |
| 331 <param name="output_settings_param" type="select" label="Change output settings?" help="Change the output settings."> | |
| 332 <option value="true">Yes</option> | |
| 333 <option value="false" selected="true">No</option> | |
| 334 </param> | |
| 335 <when value="true"> | |
| 336 <param argument="--plot_width" type="integer" value="5" min="2" max="20" label="Plot width" help="Mini alignment width in inches."/> | |
| 337 <param argument="--plot_height" type="integer" value="3" min="2" max="15" label="Plot height" help="Mini alignment height in inches."/> | |
| 338 <param argument="--plot_dpi" type="integer" min="72" max="1200" value="300" label="Plot DPI" help="DPI for mini alignments"/> | |
| 339 <param argument="--plot_keep_numbers" type="boolean" checked="false" falsevalue="" truevalue="--plot_keep_numbers" label="Plot keep numbers" help="If specified, for mini alignments based on CIAlign output with smaller than 10 sequences (or if force_numbers is switched on) the rows will be labelled based on the input alignment, rather than renumbered."/> | |
| 340 <param argument="--plot_force_numbers" type="boolean" checked="false" falsevalue="" truevalue="--plot_force_numbers" label="Plot force numbers" help="Force all rows to be numbered on the mini alignments rather than labelling e.g. every 10th row for larger plots. Will cause labels to overlap on large plots."/> | |
| 341 <param argument="--plot_identity_palette" type="text" value="bone" label="Plot identity palette" help="Matplotlib palette name for identity mini alignments."> | |
| 342 <validator type="regex">^[a-zA-Z_]+$</validator> | |
| 343 </param> | |
| 344 <param argument="--plot_identity_gap_col" type="color" value="#ffffff" label="Plot identity gap col" help="Colour for gaps in identity mini alignments."> | |
| 345 <sanitizer invalid_char=""> | |
| 346 <valid initial="string.ascii_letters,string.digits"> | |
| 347 <add value="#" /> | |
| 348 </valid> | |
| 349 </sanitizer> | |
| 350 </param> | |
| 351 <param argument="--plot_similarity_palette" type="text" value="bone" label="Plot similarity palette" help="Matplotlib palette name for similarity mini alignments."> | |
| 352 <validator type="regex">^[a-zA-Z_]+$</validator> | |
| 353 </param> | |
| 354 <param argument="--plot_similarity_gap_col" type="color" value="#ffffff" label="Plot similarity gap col" help="Colour for gaps in similarity mini alignments."> | |
| 355 <sanitizer invalid_char=""> | |
| 356 <valid initial="string.ascii_letters,string.digits"> | |
| 357 <add value="#" /> | |
| 358 </valid> | |
| 359 </sanitizer> | |
| 360 </param> | |
| 361 <param argument="--plot_sub_matrix_name" type="select" label="Substitution matrix to use for similarity plots" help="BLOSUM62 for amino acid, NUC.4.4 for nucleotide"> | |
| 362 <option value="BLOSUM62">BLOSUM62</option> | |
| 363 <option value="NUC.4.4" selected="true">NUC.4.4</option> | |
| 364 </param> | |
| 365 <param argument="--palette" type="select" value="CBS" label="Colour palette" help="Colour palette. Currently implemented CBS (colour blind safe) or bright."> | |
| 366 <option value="CBS" selected="true">CBS</option> | |
| 367 </param> | |
| 368 </when> | |
| 369 <when value="false"/> | |
| 370 </conditional> | |
| 371 </section> | |
| 372 | |
| 373 <!-- Sequence Logos --> | |
| 374 <conditional name="sequence_logo_cond"> | |
| 375 <param name="sequence_logo_param" type="select" label="Make sequence logo?" help="Draw a sequence logo."> | |
| 376 <option value="true">Yes</option> | |
| 377 <option value="false" selected="true">No</option> | |
| 378 </param> | |
| 379 <when value="true"> | |
| 380 <param argument="--sequence_logo_type" type="select" label="Type of sequence logo" help="Type of sequence logo to plot"> | |
| 381 <option value="bar">Bar</option> | |
| 382 <option value="text" selected="true">Text</option> | |
| 383 <option value="both">Both (Bar and Text)</option> | |
| 384 </param> | |
| 385 <param argument="--sequence_logo_dpi" type="integer" min="72" max="1200" value="300" label="Resolution (DPI)" help="DPI (dots per inch) for sequence logo."/> | |
| 386 <param argument="--sequence_logo_font" type="text" value="monospace" label="Logo Font" help="Font for bases / amino acids in a text based sequence logo"> | |
| 387 <validator type="regex">^[a-zA-Z\- ]+$</validator> | |
| 388 </param> | |
| 389 <param argument="--sequence_logo_nt_per_row" type="integer" value="50" label="Number of Bases/amino acids per row" help="Number of bases / amino acids to show per row in the sequence logo, where the logo is too large to show on a single line"/> | |
| 390 <param argument="--logo_start" type="integer" optional="true" label="Logo Start" help="Start sequence logo"/> | |
| 391 <param argument="--logo_end" type="integer" optional="true" label="Logo End" help="End sequence logo"/> | |
| 392 </when> | |
| 393 <when value="false"/> | |
| 394 </conditional> | |
| 395 | |
| 396 <!-- Statistics Plots --> | |
| 397 <section name="statistics_plots" title="Statistics Plots" expanded="false"> | |
| 398 <param argument="--plot_stats_input" type="boolean" checked="false" falsevalue="" truevalue="--plot_stats_input" label="Plot stats input" help="Plot the statistics for the input MSA"/> | |
| 399 <param argument="--plot_stats_output" type="boolean" checked="false" falsevalue="" truevalue="--plot_stats_output" label="Plot stats output" help="Plot the statistics for the output MSA"/> | |
| 400 <section name="stats_settings" title="Statistics Plots Settings" expanded="false"> | |
| 401 <param argument="--plot_stats_dpi" type="integer" value="300" min="72" max="1200" label="DPI" help="DPI for coverage plot"/> | |
| 402 <param argument="--plot_stats_width" type="integer" min="2" max="20" value="5" label="Plot width" help="Width for coverage plot (inches)"/> | |
| 403 <param argument="--plot_stats_height" type="integer" min="2" max="15" value="3" label="Plot height" help="Height for coverage plot (inches)"/> | |
| 404 <param argument="--plot_stats_colour" type="text" value="#0000ff" label="Colour" help="Colour for coverage plot (hex code or name)"> | |
| 405 <sanitizer invalid_char=""> | |
| 406 <valid initial="string.ascii_letters,string.digits"> | |
| 407 <add value="#" /> | |
| 408 </valid> | |
| 409 </sanitizer> | |
| 410 </param> | |
| 411 </section> | |
| 412 </section> | |
| 413 </section> | |
| 414 | |
| 415 | |
| 416 <section name="interpretation_options" title="Interpretation Options" expanded="false"> | |
| 417 <!-- Consensus Sequences --> | |
| 418 <conditional name="consensus_sequences_cond"> | |
| 419 <param name="consensus_sequences_param" type="select" label="Consensus Sequences" help="This generates a consensus sequence based on the cleaned alignment."> | |
| 420 <option value="true">Yes</option> | |
| 421 <option value="false" selected="true">No</option> | |
| 422 </param> | |
| 423 <when value="true"> | |
| 424 <!-- consensus_sequences --> | |
| 425 <param argument="--consensus_type" type="select" label="Type of consensus sequence" help="Can be majority, to use the most common character at each position in the consensus, even if this is a gap, or majority_nongap, to use the most common non-gap character at each position"> | |
| 426 <option value="majority" selected="true">majority</option> | |
| 427 <option value="majority_nongap">majority_nongap</option> | |
| 428 </param> | |
| 429 <param argument="--consensus_keep_gaps" type="boolean" truevalue="--consensus_keep_gaps" falsevalue="" checked="false" label="Include gaps?" help="Should gaps be included in the consensus"/> | |
| 430 </when> | |
| 431 <when value="false"/> | |
| 432 </conditional> | |
| 433 | |
| 434 <!-- Position Matrices --> | |
| 435 <section name="position_matrices" title="Position Matrices" expanded="false"> | |
| 436 <param argument="--pwm_input" type="boolean" checked="false" falsevalue="" truevalue="--pwm_input" label="Generate input matrices" help="Generate a position frequency matrix, position probability matrix and position weight matrix based on the input alignment"/> | |
| 437 <param argument="--pwm_output" type="boolean" checked="false" falsevalue="" truevalue="--pwm_output" label="Generate output matrices" help="Generate a position frequency matrix, position probability matrix and position weight matrix based on the cleaned output alignment"/> | |
| 438 <section name="matrices_settings" title="Position Matrices Settings" expanded="false"> | |
| 439 <param argument="--pwm_start" type="integer" optional="true" label="Start the PWM" help="Start the PWM and other matrices from this column of the input alignment"/> | |
| 440 <param argument="--pwm_end" type="integer" optional="true" label="End the PWM" help="End the PWM and other matrices at this column of the input alignment"/> | |
| 441 <param argument="--pwm_freqtype" type="select" label="Background frequency matrix" help="Choose how to compute background frequencies for the PWM: - equal: assume all residues are equally common | |
| 442 - calc: derive from the input PFM - calc2: derive from the full alignment (same as calc if no bounds) - user: provide your own frequencies (check https://davetang.org/muse/2013/10/01/position-weight-matrix/)"> | |
| 443 <option value="user">user</option> | |
| 444 <option value="equal" selected="true">equal</option> | |
| 445 <option value="calc">calc</option> | |
| 446 <option value="calc2">calc2</option> | |
| 447 </param> | |
| 448 <param argument="--pwm_alphatype" type="select" label="Pseudocount type" help="If alphatype is 'calc', alpha is calculated as frequency(base), If alpha type is 'user' the user provides the value of alpha as pwm_alphatype. To run without pseudocounts set pwm_alphatype as user and pwm_alphaval as 0."> | |
| 449 <option value="user">user</option> | |
| 450 <option value="calc" selected="true">calc</option> | |
| 451 </param> | |
| 452 <param argument="--pwm_alphaval" type="integer" value="1" label="Alpha value" help="User defined value of the alpha parameter to use as a pseudocount in the PPM."/> | |
| 453 </section> | |
| 454 <param argument="--pwm_output_blamm" type="boolean" checked="false" falsevalue="" truevalue="--pwm_output_blamm" label="Output for BLAM" help="Output PPM formatted for BLAMM software"/> | |
| 455 <param argument="--pwm_output_meme" type="boolean" checked="false" falsevalue="" truevalue="--pwm_output_meme" label="Output for MEME" help="Output PPM formatted for MEME software"/> | |
| 456 </section> | |
| 457 | |
| 458 <!-- Similarity Matrices --> | |
| 459 <section name="similarity_matrices" title="Similarity Matrices" expanded="false"> | |
| 460 <param argument="--make_similarity_matrix_input" type="boolean" checked="false" falsevalue="" truevalue="--make_similarity_matrix_input" label="Input similarity matrix" help="Make a similarity matrix for the input alignment"/> | |
| 461 <param argument="--make_similarity_matrix_output" type="boolean" checked="false" falsevalue="" truevalue="--make_similarity_matrix_output" label="Output similarity matrix" help="Make a similarity matrix for the output alignment"/> | |
| 462 <section name="similarity_matrices_settings" title="Similarity Matrices Settings" expanded="false"> | |
| 463 <param argument="--make_simmatrix_keepgaps" type="select" label="Keep gaps" help="0 - exclude positions which are gaps in either or both sequences from similarity calculations, 1 - exclude positions which are gaps in both sequences, 2 - include all positions"> | |
| 464 <option value="0" selected="true">0</option> | |
| 465 <option value="1">1</option> | |
| 466 <option value="2">2</option> | |
| 467 </param> | |
| 468 <param argument="--make_simmatrix_dp" type="integer" min="0" max="10" value="4" label="Decimal places" help="Number of decimal places to display in the similarity matrix output file"/> | |
| 469 <param argument="--make_simmatrix_minoverlap" type="integer" value="1" label="Minimum overlap" help="Minimum overlap between two sequences to have non-zero similarity in the similarity matrix"/> | |
| 470 </section> | |
| 471 </section> | |
| 472 </section> | |
| 473 | |
| 474 <!-- Editing Functions --> | |
| 475 <section name="editing_functions" title="Editing Options" expanded="false"> | |
| 476 <!-- get section --> | |
| 477 <conditional name="get_section_cond"> | |
| 478 <param name="get_section_param" type="select" label="Retrieve and process a section of the alignment?"> | |
| 479 <option value="true" >Yes</option> | |
| 480 <option value="false" selected="true">No</option> | |
| 481 </param> | |
| 482 <when value="true"> | |
| 483 <param argument="--section_start" value="" type="integer" label="Section start" help="Start position in the original alignment for the section to be extracted"/> | |
| 484 <param argument="--section_end" value="" type="integer" label="Section end" help="End position in the original alignment for the section to be extracted"/> | |
| 485 </when> | |
| 486 <when value="false"/> | |
| 487 </conditional> | |
| 488 <!-- replace bases--> | |
| 489 <param argument="--replace_input_tu" type="boolean" checked="false" falsevalue="" truevalue="--replace_input_tu" label="Replace input T - U " help="Generates a copy of the input alignment with U's instead of T's"/> | |
| 490 <param argument="--replace_input_ut" type="boolean" checked="false" falsevalue="" truevalue="--replace_input_ut" label="Replace input U - T " help="Generates a copy of the input alignment with T's instead of U's"/> | |
| 491 <param argument="--replace_output_tu" type="boolean" checked="false" falsevalue="" truevalue="--replace_output_tu" label="Replace output T - U " help="Generates a copy of the output alignment with U's instead of T's"/> | |
| 492 <param argument="--replace_output_ut" type="boolean" checked="false" falsevalue="" truevalue="--replace_output_ut" label="Replace output U -T " help="Generates a copy of the output alignment with T's instead of U's"/> | |
| 493 <!-- Unaligning --> | |
| 494 <param argument="--unalign_input" type="boolean" checked="false" falsevalue="" truevalue="--unalign_input" label="Input alignment with no gaps " help="Generates a copy of the input alignment with no gaps"/> | |
| 495 <param argument="--unalign_output" type="boolean" checked="false" falsevalue="" truevalue="--unalign_output" label="Out alignment with no gaps " help="Generates a copy of the output alignment with no gaps"/> | |
| 496 <param argument="--deduplicate_ids" type="boolean" checked="false" falsevalue="" truevalue="--deduplicate_ids" label="Remove duplicates" help="Remove sequences with duplicate names from the input."/> | |
| 497 <param argument="--duporder" type="select" label="Duplicates order" help="Set to first to keep the first instance of the sequence name and last to keep the last"> | |
| 498 <option value="first" selected="true">first</option> | |
| 499 <option value="last">last</option> | |
| 500 </param> | |
| 501 </section> | |
| 502 </inputs> | |
| 503 | |
| 504 <outputs> | |
| 505 <data name="output_cleaned" format="fasta" from_work_dir="output_cleaned.fasta" label="${tool.name} on ${on_string}: Cleaned Alignment"/> | |
| 506 <data name="output_removed" format="txt" from_work_dir="output_removed.txt" label="${tool.name} on ${on_string}: Removed Sequences"/> | |
| 507 <data name="output_log" format="txt" from_work_dir="output_log.txt" label="${tool.name} on ${on_string}: Log File"> | |
| 508 <filter>basic_options['log_out']</filter> | |
| 509 </data> | |
| 510 <!-- Visualisation Options Simple Outputs --> | |
| 511 <data name="plot_input" format="png" from_work_dir="output_input.png" label="${tool.name} on ${on_string}: Input Plot"> | |
| 512 <filter>visualisation_options['basic_visualisation_options']['plot_input'] or basic_options['visualise'] or basic_options['all']</filter> | |
| 513 </data> | |
| 514 <data name="plot_output" format="png" from_work_dir="output_output.png" label="${tool.name} on ${on_string}: Output Plot"> | |
| 515 <filter>visualisation_options['basic_visualisation_options']['plot_output'] or basic_options['visualise'] or basic_options['all']</filter> | |
| 516 </data> | |
| 517 <data name="plot_markup" format="png" from_work_dir="output_markup.png" label="${tool.name} on ${on_string}: Markup Plot"> | |
| 518 <filter>visualisation_options['basic_visualisation_options']['plot_markup'] or basic_options['visualise'] or basic_options['all']</filter> | |
| 519 </data> | |
| 520 <data name="plot_markup_legend" format="png" from_work_dir="output_markup_legend.png" label="${tool.name} on ${on_string}: Markup Legend"> | |
| 521 <filter>visualisation_options['basic_visualisation_options']['plot_markup'] or basic_options['visualise'] or basic_options['all']</filter> | |
| 522 </data> | |
| 523 <data name="plot_consensus_identity" format="png" from_work_dir="output_consensus_identity.png" label="${tool.name} on ${on_string}: Consensus Identity Plot"> | |
| 524 <filter>visualisation_options['basic_visualisation_options']['plot_consensus_identity'] or basic_options['all']</filter> | |
| 525 </data> | |
| 526 <data name="plot_consensus_similarity" format="png" from_work_dir="output_consensus_similarity.png" label="${tool.name} on ${on_string}: Consensus Similarity Plot"> | |
| 527 <filter>visualisation_options['basic_visualisation_options']['plot_consensus_similarity']</filter> | |
| 528 </data> | |
| 529 <!-- Visualisation Options Outputs --> | |
| 530 <data name="logo_bar" format="png" from_work_dir="output_logo_bar.png" label="${tool.name} on ${on_string}: Logo Bar Chart"> | |
| 531 <filter>(visualisation_options['sequence_logo_cond']['sequence_logo_param'] == 'true' and (visualisation_options['sequence_logo_cond']['sequence_logo_type'] == 'bar' or visualisation_options['sequence_logo_cond']['sequence_logo_type'] == 'both'))</filter> | |
| 532 </data> | |
| 533 <data name="logo_text" format="png" from_work_dir="output_logo_text.png" label="${tool.name} on ${on_string}: Logo Text Chart"> | |
| 534 <filter>(visualisation_options['sequence_logo_cond']['sequence_logo_param'] == 'true' and (visualisation_options['sequence_logo_cond']['sequence_logo_type'] == 'text' or visualisation_options['sequence_logo_cond']['sequence_logo_type'] == 'both'))</filter> | |
| 535 </data> | |
| 536 | |
| 537 <!-- Statistics plots of the input --> | |
| 538 <collection name="plot_stats_input" type="list" label="Input stats plots"> | |
| 539 <discover_datasets pattern="(output_input_)(?P<designation>.+)\.png$" format="png" directory="." visible="false"/> | |
| 540 <filter>visualisation_options['statistics_plots']['plot_stats_input'] or basic_options['interpret'] or basic_options['all']</filter> | |
| 541 </collection> | |
| 542 | |
| 543 <!-- Statistics plots of the output --> | |
| 544 <collection name="plot_stats_outputs" type="list" label="Output stats plots"> | |
| 545 <discover_datasets pattern="(output_output_)(?P<designation>.+)\.png$" format="png" directory="." visible="false"/> | |
| 546 <filter>visualisation_options['statistics_plots']['plot_stats_output'] or basic_options['interpret'] or basic_options['all']</filter> | |
| 547 </collection> | |
| 548 | |
| 549 <!-- Interpretaion Options Outputs --> | |
| 550 <data name="output_consensus" format="fasta" from_work_dir="output_consensus.fasta" label="${tool.name} on ${on_string}: Consensus Sequence"> | |
| 551 <filter>interpretation_options['consensus_sequences_cond']['consensus_sequences_param'] == 'true' or basic_options['interpret'] or basic_options['all']</filter> | |
| 552 </data> | |
| 553 <data name="output_with_consensus" format="fasta" from_work_dir="output_with_consensus.fasta" label="${tool.name} on ${on_string}: Cleaned + Consensus"> | |
| 554 <filter>interpretation_options['consensus_sequences_cond']['consensus_sequences_param'] == 'true' or basic_options['interpret'] or basic_options['all']</filter> | |
| 555 </data> | |
| 556 <data name="pwm_input" format="txt" from_work_dir="output_pwm_input.txt" label="${tool.name} on ${on_string}: PWM Input"> | |
| 557 <filter>interpretation_options['position_matrices']['pwm_input']</filter> | |
| 558 </data> | |
| 559 <data name="ppm_input" format="txt" from_work_dir="output_ppm_input.txt" label="${tool.name} on ${on_string}: PPM Input"> | |
| 560 <filter>interpretation_options['position_matrices']['pwm_input']</filter> | |
| 561 </data> | |
| 562 <data name="pfm_input" format="txt" from_work_dir="output_pfm_input.txt" label="${tool.name} on ${on_string}: PFM Input"> | |
| 563 <filter>interpretation_options['position_matrices']['pwm_input']</filter> | |
| 564 </data> | |
| 565 <data name="ppm_meme_input" format="txt" from_work_dir="output_ppm_meme_input.txt" label="${tool.name} on ${on_string}: PPM for MEME (Input)"> | |
| 566 <filter>interpretation_options['position_matrices']['pwm_input'] and interpretation_options['position_matrices']['pwm_output_meme']</filter> | |
| 567 </data> | |
| 568 <data name="blamm_input" format="txt" from_work_dir="output_pfm_blamm_input.txt" label="${tool.name} on ${on_string}: PFM for BLAMM (Input)"> | |
| 569 <filter>interpretation_options['position_matrices']['pwm_input'] and interpretation_options['position_matrices']['pwm_output_blamm']</filter> | |
| 570 </data> | |
| 571 <data name="pwm_output" format="txt" from_work_dir="output_pwm_output.txt" label="${tool.name} on ${on_string}: PWM Output"> | |
| 572 <filter>interpretation_options['position_matrices']['pwm_output']</filter> | |
| 573 </data> | |
| 574 <data name="ppm_output" format="txt" from_work_dir="output_ppm_output.txt" label="${tool.name} on ${on_string}: PPM Output"> | |
| 575 <filter>interpretation_options['position_matrices']['pwm_output']</filter> | |
| 576 </data> | |
| 577 <data name="pfm_output" format="txt" from_work_dir="output_pfm_output.txt" label="${tool.name} on ${on_string}: PFM Output"> | |
| 578 <filter>interpretation_options['position_matrices']['pwm_output']</filter> | |
| 579 </data> | |
| 580 <data name="ppm_meme_output" format="txt" from_work_dir="output_ppm_meme_output.txt" label="${tool.name} on ${on_string}: PPM for MEME (Output)"> | |
| 581 <filter>interpretation_options['position_matrices']['pwm_output'] and interpretation_options['position_matrices']['pwm_output_meme']</filter> | |
| 582 </data> | |
| 583 <data name="blamm_output" format="txt" from_work_dir="output_pfm_blamm_output.txt" label="${tool.name} on ${on_string}: PFM for BLAMM (Output)"> | |
| 584 <filter>interpretation_options['position_matrices']['pwm_output'] and interpretation_options['position_matrices']['pwm_output_blamm']</filter> | |
| 585 </data> | |
| 586 <data name="input_similarity" format="tsv" from_work_dir="output_input_similarity.tsv" label="${tool.name} on ${on_string}: Input Similarity"> | |
| 587 <filter>interpretation_options['similarity_matrices']['make_similarity_matrix_input'] or basic_options['interpret'] or basic_options['all']</filter> | |
| 588 </data> | |
| 589 <data name="output_similarity" format="tsv" from_work_dir="output_output_similarity.tsv" label="${tool.name} on ${on_string}: Output Similarity"> | |
| 590 <filter>interpretation_options['similarity_matrices']['make_similarity_matrix_output'] or basic_options['interpret'] or basic_options['all']</filter> | |
| 591 </data> | |
| 592 <data name="output_output_column_stats" format="tsv" from_work_dir="output_output_column_stats.tsv" label="${tool.name} on ${on_string}: Output column stats"> | |
| 593 <filter>basic_options['interpret'] or basic_options['all']</filter> | |
| 594 </data> | |
| 595 <data name="output_input_column_stats" format="tsv" from_work_dir="output_output_column_stats.tsv" label="${tool.name} on ${on_string}: Input column stats"> | |
| 596 <filter>basic_options['interpret'] or basic_options['all']</filter> | |
| 597 </data> | |
| 598 <!-- Editing Options Outputs --> | |
| 599 <data name="U_input" format="fasta" from_work_dir="output_U_input.fasta" label="${tool.name} on ${on_string}: Input: U instead of T"> | |
| 600 <filter>editing_functions['replace_input_tu']</filter> | |
| 601 </data> | |
| 602 <data name="T_input" format="fasta" from_work_dir="output_T_input.fasta" label="${tool.name} on ${on_string}: Input: T instead of U"> | |
| 603 <filter>editing_functions['replace_input_ut']</filter> | |
| 604 </data> | |
| 605 <data name="U_output" format="fasta" from_work_dir="output_U_output.fasta" label="${tool.name} on ${on_string}: Output: U instead of T"> | |
| 606 <filter>editing_functions['replace_output_tu']</filter> | |
| 607 </data> | |
| 608 <data name="T_output" format="fasta" from_work_dir="output_T_output.fasta" label="${tool.name} on ${on_string}: Output: T instead of U"> | |
| 609 <filter>editing_functions['replace_output_ut']</filter> | |
| 610 </data> | |
| 611 <data name="unaligned_input" format="fasta" from_work_dir="output_unaligned_input.fasta" label="${tool.name} on ${on_string}: Unaligned Input"> | |
| 612 <filter>editing_functions['unalign_input']</filter> | |
| 613 </data> | |
| 614 <data name="unaligned_output" format="fasta" from_work_dir="output_unaligned_output.fasta" label="${tool.name} on ${on_string}: Unaligned Output"> | |
| 615 <filter>editing_functions['unalign_output']</filter> | |
| 616 </data> | |
| 617 </outputs> | |
| 618 <tests> | |
| 619 <!-- Test 1 gzip files --> | |
| 620 <test expect_num_outputs="3"> | |
| 621 <param name="input" value="example3.fasta.gz" ftype="fasta"/> | |
| 622 <section name="basic_options"> | |
| 623 <param name="log_out" value="true"/> | |
| 624 </section> | |
| 625 <output name="output_cleaned" ftype="fasta"> | |
| 626 <assert_contents> | |
| 627 <has_n_lines n="4"/> | |
| 628 </assert_contents> | |
| 629 </output> | |
| 630 <output name="output_removed" ftype="txt"> | |
| 631 <assert_contents> | |
| 632 <has_n_lines n="0"/> | |
| 633 </assert_contents> | |
| 634 </output> | |
| 635 <output name="output_log"> | |
| 636 <assert_contents> | |
| 637 <has_text text="Command Line Args:"/> | |
| 638 </assert_contents> | |
| 639 </output> | |
| 640 </test> | |
| 641 <!-- Test 2 to check clean mode --> | |
| 642 <test expect_num_outputs="3"> | |
| 643 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 644 <section name="basic_options"> | |
| 645 <param name="clean" value="true"/> | |
| 646 <param name="log_out" value="true"/> | |
| 647 </section> | |
| 648 <output name="output_cleaned" ftype="fasta"> | |
| 649 <assert_contents> | |
| 650 <has_n_lines n="10"/> | |
| 651 <has_line_matching expression="AUUCUAUCUGGGUGACUAUUCGUUAUCUCUACUUACUAUCUUACUUACUUACUUACGCUACGUACUAGCUUACGUACUGACUU" /> | |
| 652 </assert_contents> | |
| 653 </output> | |
| 654 <output name="output_removed" ftype="txt"> | |
| 655 <assert_contents> | |
| 656 <has_n_lines n="7"/> | |
| 657 <has_line_matching expression="remove_gap_only\s+89,90,91" /> | |
| 658 </assert_contents> | |
| 659 </output> | |
| 660 <output name="output_log"> | |
| 661 <assert_contents> | |
| 662 <has_text text="Command Line Args:"/> | |
| 663 </assert_contents> | |
| 664 </output> | |
| 665 </test> | |
| 666 <!-- Test 3 to clean amino acid --> | |
| 667 <test expect_num_outputs="3"> | |
| 668 <param name="input" value="example2.fasta" ftype="fasta"/> | |
| 669 <section name="basic_options"> | |
| 670 <param name="clean" value="true"/> | |
| 671 <param name="log_out" value="true"/> | |
| 672 </section> | |
| 673 <section name="cleaning_options"> | |
| 674 <conditional name="retain_cond"> | |
| 675 <param name="retain_param" value="true"/> | |
| 676 <repeat name="retain_seqs"> | |
| 677 <param name="retain" value="seq1"/> | |
| 678 </repeat> | |
| 679 </conditional> | |
| 680 </section> | |
| 681 <output name="output_cleaned" ftype="fasta"> | |
| 682 <assert_contents> | |
| 683 <has_n_lines n="2"/> | |
| 684 <has_line_matching expression="MKTAIKDLGTEYKLTVAEYFR" /> | |
| 685 </assert_contents> | |
| 686 </output> | |
| 687 <output name="output_removed" ftype="txt"> | |
| 688 <assert_contents> | |
| 689 <has_n_lines n="2"/> | |
| 690 <has_line_matching expression="remove_gap_only\s+3,4" /> | |
| 691 </assert_contents> | |
| 692 </output> | |
| 693 <output name="output_log"> | |
| 694 <assert_contents> | |
| 695 <has_text text="Amino acid alignment detected"/> | |
| 696 </assert_contents> | |
| 697 </output> | |
| 698 </test> | |
| 699 <!-- Test 4 to check visualise mode --> | |
| 700 <test expect_num_outputs="7"> | |
| 701 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 702 <section name="basic_options"> | |
| 703 <param name="visualise" value="true"/> | |
| 704 <param name="log_out" value="true"/> | |
| 705 </section> | |
| 706 <output name="output_cleaned" ftype="fasta"> | |
| 707 <assert_contents> | |
| 708 <has_n_lines n="14"/> | |
| 709 <has_line_matching expression="AGUCUAUCUGGGGUACUAUCUA------UCGCUACGUACUAGCUUACGUACUGACUUA--CGCUACGUACUAGCUUACGUACUGACUUA----"/> | |
| 710 </assert_contents> | |
| 711 </output> | |
| 712 <output name="output_removed" ftype="txt"> | |
| 713 <assert_contents> | |
| 714 <has_n_lines n="1"/> | |
| 715 <has_line_matching expression="remove_gap_only\s+89,90,91" /> | |
| 716 </assert_contents> | |
| 717 </output> | |
| 718 <output name="output_log"> | |
| 719 <assert_contents> | |
| 720 <has_text text="Command Line Args:"/> | |
| 721 </assert_contents> | |
| 722 </output> | |
| 723 <output name="plot_input"> | |
| 724 <assert_contents> | |
| 725 <has_image_height height="870"/> | |
| 726 <has_image_width width="1469"/> | |
| 727 </assert_contents> | |
| 728 </output> | |
| 729 <output name="plot_output"> | |
| 730 <assert_contents> | |
| 731 <has_image_channels channels="4"/> | |
| 732 <has_image_height height="870"/> | |
| 733 <has_image_width width="1470"/> | |
| 734 </assert_contents> | |
| 735 </output> | |
| 736 <output name="plot_output"> | |
| 737 <assert_contents> | |
| 738 <has_image_channels channels="4"/> | |
| 739 <has_image_height height="870"/> | |
| 740 <has_image_width width="1470"/> | |
| 741 </assert_contents> | |
| 742 </output> | |
| 743 <output name="plot_markup"> | |
| 744 <assert_contents> | |
| 745 <has_image_channels channels="4"/> | |
| 746 <has_image_height height="870"/> | |
| 747 <has_image_width width="1469"/> | |
| 748 </assert_contents> | |
| 749 </output> | |
| 750 <output name="plot_markup_legend"> | |
| 751 <assert_contents> | |
| 752 <has_image_channels channels="4"/> | |
| 753 <has_image_height height="174"/> | |
| 754 <has_image_width width="187"/> | |
| 755 </assert_contents> | |
| 756 </output> | |
| 757 </test> | |
| 758 <!-- Test 5 "remove divergent"" --> | |
| 759 <test expect_num_outputs="2"> | |
| 760 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 761 <section name="cleaning_options"> | |
| 762 <conditional name="remove_divergent_cond"> | |
| 763 <param name="remove_divergent_param" value="true"/> | |
| 764 <param name="remove_divergent_minperc" value="0.9"/> | |
| 765 <repeat name="remove_divergent_retain_seqs"> | |
| 766 <param name="remove_divergent_retain" value="Seq1"/> | |
| 767 </repeat> | |
| 768 <repeat name="remove_divergent_retain_seqs"> | |
| 769 <param name="remove_divergent_retain" value="Seq2"/> | |
| 770 </repeat> | |
| 771 </conditional> | |
| 772 </section> | |
| 773 <output name="output_cleaned" ftype="fasta"> | |
| 774 <assert_contents> | |
| 775 <has_n_lines n="10"/> | |
| 776 <not_has_text text="Seq4"/> | |
| 777 </assert_contents> | |
| 778 </output> | |
| 779 <output name="output_removed" ftype="txt"> | |
| 780 <assert_contents> | |
| 781 <has_n_lines n="2"/> | |
| 782 <has_text text="remove_divergent"/> | |
| 783 </assert_contents> | |
| 784 </output> | |
| 785 </test> | |
| 786 <!-- Test 6 "remove rare insertion"" --> | |
| 787 <test expect_num_outputs="2"> | |
| 788 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 789 <section name="cleaning_options"> | |
| 790 <conditional name="remove_insertions_cond"> | |
| 791 <param name="remove_insertions_param" value="true"/> | |
| 792 <param name="insertion_min_size" value="3"/> | |
| 793 <param name="insertion_max_size" value="150"/> | |
| 794 <param name="insertion_min_flank" value="5"/> | |
| 795 <param name="insertion_min_perc" value="0.6"/> | |
| 796 </conditional> | |
| 797 </section> | |
| 798 <output name="output_cleaned" ftype="fasta"> | |
| 799 <assert_contents> | |
| 800 <has_n_lines n="14"/> | |
| 801 <has_line_matching expression="AGUCUAUCUGGGGUACUAUCUAUCGCUACGUACUAGCUUACGUACUGACUUA--CGCUACGUACUAGCUUACGUACUGACUUA----"/> | |
| 802 </assert_contents> | |
| 803 </output> | |
| 804 <output name="output_removed" ftype="txt"> | |
| 805 <assert_contents> | |
| 806 <has_n_lines n="2"/> | |
| 807 <has_line_matching expression="remove_gap_only\s+89,90,91"/> | |
| 808 </assert_contents> | |
| 809 </output> | |
| 810 </test> | |
| 811 <!-- Test 7 "Crop Sequence Ends"" --> | |
| 812 <test expect_num_outputs="2"> | |
| 813 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 814 <section name="cleaning_options"> | |
| 815 <conditional name="crop_ends_cond"> | |
| 816 <param name="crop_ends_param" value="true"/> | |
| 817 <param name="crop_ends_mingap_perc" value="0.05"/> | |
| 818 <param name="crop_ends_redefine_perc" value="0.1"/> | |
| 819 <repeat name="crop_ends_retain_strings"> | |
| 820 <param name="crop_ends_retain_str" value="q7"/> | |
| 821 </repeat> | |
| 822 </conditional> | |
| 823 </section> | |
| 824 <output name="output_cleaned" ftype="fasta"> | |
| 825 <assert_contents> | |
| 826 <has_n_lines n="14"/> | |
| 827 <has_line_matching expression="AUUCUAUCUGGGUACUAUUGGG------UUAUCUCUACUUACUAUCUUACAGACUUGGUUA----------------------------AAAA"/> | |
| 828 </assert_contents> | |
| 829 </output> | |
| 830 <output name="output_removed" ftype="txt"> | |
| 831 <assert_contents> | |
| 832 <has_n_lines n="2"/> | |
| 833 <has_line_matching expression="remove_gap_only\s+89,90,91"/> | |
| 834 </assert_contents> | |
| 835 </output> | |
| 836 </test> | |
| 837 <!-- Test 8 "Remove Short Sequences"" --> | |
| 838 <test expect_num_outputs="2"> | |
| 839 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 840 <section name="cleaning_options"> | |
| 841 <conditional name="remove_short_cond"> | |
| 842 <param name="remove_short_param" value="true"/> | |
| 843 <param name="remove_min_length" value="70"/> | |
| 844 <repeat name="remove_short_retain_seqs"> | |
| 845 <param name="remove_short_retain" value="Seq1"/> | |
| 846 </repeat> | |
| 847 <repeat name="remove_short_retain_strings"> | |
| 848 <param name="remove_short_retain_str" value="q2"/> | |
| 849 </repeat> | |
| 850 </conditional> | |
| 851 </section> | |
| 852 <output name="output_cleaned" ftype="fasta"> | |
| 853 <assert_contents> | |
| 854 <has_n_lines n="8"/> | |
| 855 <not_has_text text="Seq5"/> | |
| 856 </assert_contents> | |
| 857 </output> | |
| 858 <output name="output_removed" ftype="txt"> | |
| 859 <assert_contents> | |
| 860 <has_n_lines n="2"/> | |
| 861 <has_text text="remove_too_short"/> | |
| 862 </assert_contents> | |
| 863 </output> | |
| 864 </test> | |
| 865 <!-- Test 9 "Crop Divergent" --> | |
| 866 <test expect_num_outputs="2"> | |
| 867 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 868 <section name="cleaning_options"> | |
| 869 <conditional name="crop_divergent_cond"> | |
| 870 <param name="crop_divergent_param" value="true"/> | |
| 871 <param name="crop_divergent_min_prop_ident" value="0.5"/> | |
| 872 <param name="crop_divergent_min_prop_nongap" value="0.5"/> | |
| 873 <param name="crop_divergent_buffer_size" value="5"/> | |
| 874 </conditional> | |
| 875 </section> | |
| 876 <output name="output_cleaned" ftype="fasta"> | |
| 877 <assert_contents> | |
| 878 <has_n_lines n="14"/> | |
| 879 <has_line_matching expression="AUUCUAUC------UAUUGG--------UUAUCU-------------------------------------------------------"/> | |
| 880 </assert_contents> | |
| 881 </output> | |
| 882 <output name="output_removed" ftype="txt"> | |
| 883 <assert_contents> | |
| 884 <has_n_lines n="1"/> | |
| 885 <has_line_matching expression="crop_divergent\s+89,90,91,92,93,94,95"/> | |
| 886 </assert_contents> | |
| 887 </output> | |
| 888 </test> | |
| 889 <!-- Test 10 "Retain" --> | |
| 890 <test expect_num_outputs="2"> | |
| 891 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 892 <section name="cleaning_options"> | |
| 893 <conditional name="remove_short_cond"> | |
| 894 <param name="remove_short_param" value="true"/> | |
| 895 <param name="remove_min_length" value="90"/> | |
| 896 </conditional> | |
| 897 <conditional name="retain_cond"> | |
| 898 <param name="retain_param" value="true"/> | |
| 899 <repeat name="retain_seqs"> | |
| 900 <param name="retain" value="Seq1"/> | |
| 901 </repeat> | |
| 902 <repeat name="retain_strings"> | |
| 903 <param name="retain_str" value="q2"/> | |
| 904 </repeat> | |
| 905 </conditional> | |
| 906 <param name="keep_gaponly" value="true"/> | |
| 907 </section> | |
| 908 <output name="output_cleaned" ftype="fasta"> | |
| 909 <assert_contents> | |
| 910 <has_n_lines n="4"/> | |
| 911 <not_has_text text="Seq3"/> | |
| 912 </assert_contents> | |
| 913 </output> | |
| 914 <output name="output_removed" ftype="txt"> | |
| 915 <assert_contents> | |
| 916 <has_n_lines n="1"/> | |
| 917 <has_text text="remove_too_short"/> | |
| 918 </assert_contents> | |
| 919 </output> | |
| 920 </test> | |
| 921 <!-- Test 11 "Visualise basic options + settings" --> | |
| 922 <test expect_num_outputs="6"> | |
| 923 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 924 <section name="visualisation_options"> | |
| 925 <section name="basic_visualisation_options"> | |
| 926 <param name="plot_consensus_identity" value="true"/> | |
| 927 <param name="plot_consensus_similarity" value="true"/> | |
| 928 <param name="plot_markup" value="true"/> | |
| 929 <conditional name="output_settings_cond"> | |
| 930 <param name="output_settings_param" value="true"/> | |
| 931 <param name="plot_width" value="5"/> | |
| 932 <param name="plot_height" value="3"/> | |
| 933 <param name="plot_dpi" value="300"/> | |
| 934 <param name="plot_keep_numbers" value="true"/> | |
| 935 <param name="plot_force_numbers" value="false"/> | |
| 936 <param name="plot_identity_palette" value="bone"/> | |
| 937 <param name="plot_identity_gap_col" value="#ffffff"/> | |
| 938 <param name="plot_similarity_palette" value="bone"/> | |
| 939 <param name="plot_similarity_gap_col" value="#ffffff"/> | |
| 940 <param name="palette" value="CBS"/> | |
| 941 </conditional> | |
| 942 </section> | |
| 943 </section> | |
| 944 <output name="output_cleaned" ftype="fasta"> | |
| 945 <assert_contents> | |
| 946 <has_n_lines n="14"/> | |
| 947 <has_line_matching expression=">Seq1"/> | |
| 948 </assert_contents> | |
| 949 </output> | |
| 950 <output name="output_removed" ftype="txt"> | |
| 951 <assert_contents> | |
| 952 <has_n_lines n="1"/> | |
| 953 <has_line_matching expression="remove_gap_only\s+89,90,91"/> | |
| 954 </assert_contents> | |
| 955 </output> | |
| 956 <output name="plot_consensus_identity" ftype="png"> | |
| 957 <assert_contents> | |
| 958 <has_image_channels channels="4"/> | |
| 959 <has_image_height height="870"/> | |
| 960 <has_image_width width="1470"/> | |
| 961 </assert_contents> | |
| 962 </output> | |
| 963 <output name="plot_consensus_similarity" ftype="png"> | |
| 964 <assert_contents> | |
| 965 <has_image_channels channels="4"/> | |
| 966 <has_image_height height="870"/> | |
| 967 <has_image_width width="1470"/> | |
| 968 </assert_contents> | |
| 969 </output> | |
| 970 <output name="plot_markup" ftype="png"> | |
| 971 <assert_contents> | |
| 972 <has_image_channels channels="4"/> | |
| 973 <has_image_height height="870"/> | |
| 974 <has_image_width width="1469"/> | |
| 975 </assert_contents> | |
| 976 </output> | |
| 977 <output name="plot_markup_legend" ftype="png"> | |
| 978 <assert_contents> | |
| 979 <has_image_channels channels="4"/> | |
| 980 <has_image_height height="174"/> | |
| 981 <has_image_width width="187"/> | |
| 982 </assert_contents> | |
| 983 </output> | |
| 984 </test> | |
| 985 <!-- Test 12 "Visualise statistics plots and settings" --> | |
| 986 <test expect_num_outputs="3"> | |
| 987 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 988 <section name="visualisation_options"> | |
| 989 <section name="statistics_plots"> | |
| 990 <param name="plot_stats_input" value="true"/> | |
| 991 <section name="stats_settings"> | |
| 992 <param name="plot_stats_dpi" value="300"/> | |
| 993 <param name="plot_stats_width" value="5"/> | |
| 994 <param name="plot_stats_height" value="3"/> | |
| 995 </section> | |
| 996 </section> | |
| 997 </section> | |
| 998 <output name="output_cleaned" ftype="fasta"> | |
| 999 <assert_contents> | |
| 1000 <has_n_lines n="14"/> | |
| 1001 <has_line_matching expression=">Seq1"/> | |
| 1002 </assert_contents> | |
| 1003 </output> | |
| 1004 <output name="output_removed" ftype="txt"> | |
| 1005 <assert_contents> | |
| 1006 <has_n_lines n="1"/> | |
| 1007 </assert_contents> | |
| 1008 </output> | |
| 1009 <output_collection name="plot_stats_input" type="list" count="5"> | |
| 1010 <element name="changefreq" ftype="png"> | |
| 1011 <assert_contents> | |
| 1012 <has_image_channels channels="4"/> | |
| 1013 <has_image_height height="1340" delta="100"/> | |
| 1014 <has_image_width width="2331"/> | |
| 1015 </assert_contents> | |
| 1016 </element> | |
| 1017 <element name="coverage" ftype="png"> | |
| 1018 <assert_contents> | |
| 1019 <has_image_channels channels="4"/> | |
| 1020 <has_image_height height="1470"/> | |
| 1021 <has_image_width width="869"/> | |
| 1022 </assert_contents> | |
| 1023 </element> | |
| 1024 <element name="information_content" ftype="png"> | |
| 1025 <assert_contents> | |
| 1026 <has_image_channels channels="4"/> | |
| 1027 <has_image_height height="1470"/> | |
| 1028 <has_image_width width="869"/> | |
| 1029 </assert_contents> | |
| 1030 </element> | |
| 1031 <element name="shannon_entropy" ftype="png"> | |
| 1032 <assert_contents> | |
| 1033 <has_image_channels channels="4"/> | |
| 1034 <has_image_height height="1470"/> | |
| 1035 <has_image_width width="869"/> | |
| 1036 </assert_contents> | |
| 1037 </element> | |
| 1038 <element name="resfreq" ftype="png"> | |
| 1039 <assert_contents> | |
| 1040 <has_image_channels channels="4"/> | |
| 1041 <has_image_height height="1403"/> | |
| 1042 <has_image_width width="1008"/> | |
| 1043 </assert_contents> | |
| 1044 </element> | |
| 1045 </output_collection> | |
| 1046 </test> | |
| 1047 <!-- Test 13 "Consensus Sequences" --> | |
| 1048 <test expect_num_outputs="4"> | |
| 1049 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 1050 <section name="interpretation_options"> | |
| 1051 <conditional name="consensus_sequences_cond"> | |
| 1052 <param name="consensus_sequences_param" value="true"/> | |
| 1053 <param name="consensus_type" value="majority"/> | |
| 1054 <param name="consensus_keep_gaps" value="true"/> | |
| 1055 </conditional> | |
| 1056 </section> | |
| 1057 <output name="output_cleaned" ftype="fasta"> | |
| 1058 <assert_contents> | |
| 1059 <has_n_lines n="14"/> | |
| 1060 <has_line_matching expression=">Seq1"/> | |
| 1061 </assert_contents> | |
| 1062 </output> | |
| 1063 <output name="output_removed" ftype="txt"> | |
| 1064 <assert_contents> | |
| 1065 <has_n_lines n="1"/> | |
| 1066 </assert_contents> | |
| 1067 </output> | |
| 1068 <output name="output_consensus" ftype="fasta"> | |
| 1069 <assert_contents> | |
| 1070 <has_n_lines n="2"/> | |
| 1071 <has_line_matching expression=">consensus"/> | |
| 1072 </assert_contents> | |
| 1073 </output> | |
| 1074 <output name="output_with_consensus" ftype="fasta"> | |
| 1075 <assert_contents> | |
| 1076 <has_n_lines n="16"/> | |
| 1077 <has_line_matching expression=">consensus"/> | |
| 1078 </assert_contents> | |
| 1079 </output> | |
| 1080 </test> | |
| 1081 <!-- Test 14 "Position Matrices" --> | |
| 1082 <test expect_num_outputs="7"> | |
| 1083 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 1084 <section name="interpretation_options"> | |
| 1085 <section name="position_matrices"> | |
| 1086 <param name="pwm_input" value="true"/> | |
| 1087 <section name="matrices_settings"> | |
| 1088 <param name="pwm_start" value="1"/> | |
| 1089 <param name="pwm_end" value="100"/> | |
| 1090 <param name="pwm_freqtype" value="equal"/> | |
| 1091 <param name="pwm_alphatype" value="calc"/> | |
| 1092 <param name="pwm_alphaval" value="1"/> | |
| 1093 </section> | |
| 1094 <param name="pwm_output_blamm" value="true"/> | |
| 1095 <param name="pwm_output_meme" value="true"/> | |
| 1096 </section> | |
| 1097 </section> | |
| 1098 <output name="output_cleaned" ftype="fasta"> | |
| 1099 <assert_contents> | |
| 1100 <has_n_lines n="14"/> | |
| 1101 <has_line_matching expression=">Seq1"/> | |
| 1102 </assert_contents> | |
| 1103 </output> | |
| 1104 <output name="output_removed" ftype="txt"> | |
| 1105 <assert_contents> | |
| 1106 <has_n_lines n="1"/> | |
| 1107 </assert_contents> | |
| 1108 </output> | |
| 1109 <output name="pwm_input" ftype="txt"> | |
| 1110 <assert_contents> | |
| 1111 <has_n_lines n="5"/> | |
| 1112 </assert_contents> | |
| 1113 </output> | |
| 1114 <output name="ppm_input" ftype="txt"> | |
| 1115 <assert_contents> | |
| 1116 <has_n_lines n="5"/> | |
| 1117 </assert_contents> | |
| 1118 </output> | |
| 1119 <output name="pfm_input" ftype="txt"> | |
| 1120 <assert_contents> | |
| 1121 <has_n_lines n="5"/> | |
| 1122 </assert_contents> | |
| 1123 </output> | |
| 1124 <output name="ppm_meme_input" ftype="txt"> | |
| 1125 <assert_contents> | |
| 1126 <has_n_lines n="103"/> | |
| 1127 </assert_contents> | |
| 1128 </output> | |
| 1129 <output name="blamm_input" ftype="txt"> | |
| 1130 <assert_contents> | |
| 1131 <has_n_lines n="5"/> | |
| 1132 </assert_contents> | |
| 1133 </output> | |
| 1134 </test> | |
| 1135 <!-- Test 15 "Similarity Sequences" --> | |
| 1136 <test expect_num_outputs="3"> | |
| 1137 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 1138 <section name="interpretation_options"> | |
| 1139 <section name="similarity_matrices"> | |
| 1140 <param name="make_similarity_matrix_input" value="true"/> | |
| 1141 <section name="similarity_matrices_settings"> | |
| 1142 <param name="make_simmatrix_keepgaps" value="0"/> | |
| 1143 <param name="make_simmatrix_dp" value="4"/> | |
| 1144 <param name="make_simmatrix_minoverlap" value="1"/> | |
| 1145 </section> | |
| 1146 </section> | |
| 1147 </section> | |
| 1148 <output name="output_cleaned" ftype="fasta"> | |
| 1149 <assert_contents> | |
| 1150 <has_n_lines n="14"/> | |
| 1151 <has_line_matching expression=">Seq1"/> | |
| 1152 </assert_contents> | |
| 1153 </output> | |
| 1154 <output name="output_removed" ftype="txt"> | |
| 1155 <assert_contents> | |
| 1156 <has_n_lines n="1"/> | |
| 1157 </assert_contents> | |
| 1158 </output> | |
| 1159 <output name="input_similarity" ftype="tsv"> | |
| 1160 <assert_contents> | |
| 1161 <has_n_lines n="8"/> | |
| 1162 </assert_contents> | |
| 1163 </output> | |
| 1164 </test> | |
| 1165 <!-- Test 16 "Extract Part of Alignment" --> | |
| 1166 <test expect_num_outputs="2"> | |
| 1167 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 1168 <section name="editing_functions"> | |
| 1169 <conditional name="get_section_cond"> | |
| 1170 <param name="get_section_param" value="true"/> | |
| 1171 <param name="section_start" value="10"/> | |
| 1172 <param name="section_end" value="50"/> | |
| 1173 </conditional> | |
| 1174 </section> | |
| 1175 <output name="output_cleaned" ftype="fasta"> | |
| 1176 <assert_contents> | |
| 1177 <has_n_lines n="14"/> | |
| 1178 <has_line_matching expression=">Seq1"/> | |
| 1179 </assert_contents> | |
| 1180 </output> | |
| 1181 <output name="output_removed" ftype="txt"> | |
| 1182 <assert_contents> | |
| 1183 <has_n_lines n="1"/> | |
| 1184 </assert_contents> | |
| 1185 </output> | |
| 1186 </test> | |
| 1187 <!-- Test 17 "Replace U ↔ T" --> | |
| 1188 <test expect_num_outputs="3"> | |
| 1189 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 1190 <section name="editing_functions"> | |
| 1191 <param name="replace_input_ut" value="true"/> | |
| 1192 </section> | |
| 1193 <output name="output_cleaned" ftype="fasta"> | |
| 1194 <assert_contents> | |
| 1195 <has_n_lines n="14"/> | |
| 1196 </assert_contents> | |
| 1197 </output> | |
| 1198 <output name="output_removed" ftype="txt"> | |
| 1199 <assert_contents> | |
| 1200 <has_n_lines n="1"/> | |
| 1201 </assert_contents> | |
| 1202 </output> | |
| 1203 <output name="T_input" ftype="fasta"> | |
| 1204 <assert_contents> | |
| 1205 <not_has_text text="U"/> | |
| 1206 </assert_contents> | |
| 1207 </output> | |
| 1208 </test> | |
| 1209 <!-- Test 18 "Unalign (remove gaps)" --> | |
| 1210 <test expect_num_outputs="3"> | |
| 1211 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 1212 <section name="editing_functions"> | |
| 1213 <param name="unalign_input" value="true"/> | |
| 1214 </section> | |
| 1215 <output name="output_cleaned" ftype="fasta"> | |
| 1216 <assert_contents> | |
| 1217 <has_n_lines n="14"/> | |
| 1218 <has_line_matching expression=">Seq1"/> | |
| 1219 </assert_contents> | |
| 1220 </output> | |
| 1221 <output name="output_removed" ftype="txt"> | |
| 1222 <assert_contents> | |
| 1223 <has_n_lines n="1"/> | |
| 1224 </assert_contents> | |
| 1225 </output> | |
| 1226 <output name="unaligned_input" ftype="fasta"> | |
| 1227 <assert_contents> | |
| 1228 <not_has_text text="-"/> | |
| 1229 </assert_contents> | |
| 1230 </output> | |
| 1231 </test> | |
| 1232 <!-- Test 19 "Remove Duplicates" --> | |
| 1233 <test expect_num_outputs="2"> | |
| 1234 <param name="input" value="example1.fasta" ftype="fasta"/> | |
| 1235 <section name="editing_functions"> | |
| 1236 <param name="deduplicate_ids" value="true"/> | |
| 1237 </section> | |
| 1238 <output name="output_cleaned" ftype="fasta"> | |
| 1239 <assert_contents> | |
| 1240 <has_n_lines n="14"/> | |
| 1241 <has_line_matching expression=">Seq1"/> | |
| 1242 </assert_contents> | |
| 1243 </output> | |
| 1244 <output name="output_removed" ftype="txt"> | |
| 1245 <assert_contents> | |
| 1246 <has_n_lines n="1"/> | |
| 1247 </assert_contents> | |
| 1248 </output> | |
| 1249 </test> | |
| 1250 </tests> | |
| 1251 <expand macro="help"/> | |
| 1252 <expand macro="citations"/> | |
| 1253 <expand macro="creator"/> | |
| 1254 </tool> |
