Mercurial > repos > iuc > chira_map
diff chira_map.xml @ 0:bbeefa1f6bd0 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/chira commit e4f841daf49048d6c656d50cffb344b53eebeec2"
| author | iuc |
|---|---|
| date | Sun, 19 Jan 2020 21:27:42 +0000 |
| parents | |
| children | 3ce9ccf8c994 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/chira_map.xml Sun Jan 19 21:27:42 2020 +0000 @@ -0,0 +1,148 @@ +<tool id="chira_map" name="ChiRA map" version="@WRAPPER_VERSION@0"> + <description>map reads to trascriptome</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <command detect_errors="aggressive"><![CDATA[ + chira_map.py -b + -a '$alignment.aligner' + -i '$query' + -b + #if str($alignment.aligner) == "bwa": + -s '$alignment.stranded' + -l1 '$alignment.seed_length1' + -l2 '$alignment.seed_length2' + -s1 '$alignment.align_score1' + -s2 '$alignment.align_score2' + #else if str($alignment.aligner) == "clan": + -s2 '$alignment.align_score' + #end if + #if str($reference.ref_type) == "single": + -f1 '$reference.ref_fasta' + #else if str($reference.ref_type) == "split": + -f1 '$reference.ref_fasta1' + -f2 '$reference.ref_fasta2' + #end if + -co '$chimeric_overlap' + -p "\${GALAXY_SLOTS:-4}" + -o ./ + + ]]></command> + + <inputs> + <param format="fasta" name="query" type="data" label="Input FASTA file" + help="Input fasta file"/> + <conditional name="reference"> + <param name="ref_type" type="select" label="Single or split reference?" + help="Use single if you have all the transcripts in single fasta file. Use split, if you split the + reference into two such that each chimeric read arm corresponds to one of them"> + <option value="split">Split reference</option> + <option value="single">Single reference</option> + </param> + <when value="split"> + <param format="fasta" name="ref_fasta1" type="data" label="Reference FASTA file" + help="Reference fasta file"/> + <param format="fasta" name="ref_fasta2" type="data" label="Second reference FASTA file" + help="Second reference fasta file."/> + </when> + <when value="single"> + <param format="fasta" name="ref_fasta" type="data" label="Reference FASTA file" + help="Reference fasta file"/> + </when> + </conditional> + <conditional name="alignment" label="Aligner to use"> + <param name="aligner" type="select"> + <option value="bwa">BWA-MEM</option> + <option value="clan">CLAN</option> + </param> + <when value="bwa"> + <param name="stranded" type="select" label="Map reads to"> + <option value="fw">Transcript strand only</option> + <option value="rc">Reverse compliment of transcript strand only</option> + <option value="both">Try both strands</option> + </param> + <param name="seed_length1" type="integer" value="12" label="Seed length 1" min="1" + help="Seed length for 1st mapping iteration. bwa-mem parameter -k"/> + <param name="seed_length2" type="integer" value="6" label="Seed length 2" min="1" + help="Seed length for 2nd mapping iteration. bwa-mem parameter -k"/> + <param name="align_score1" type="integer" value="18" label="Minimum alignmnet score 1" min="1" + help="Minimum alignment score in 1st mapping iteration. It + must be smaller than --align_score1 parameter. bwa-mem parameter '-T'"/> + <param name="align_score2" type="integer" value="10" label="Minimum alignmnet score 2" min="1" + help="Minimum alignment score in 2nd mapping iteration. bwa-mem parameter '-T'"/> + </when> + <when value="clan"> + <param name="align_score" type="integer" value="10" label="Minimum length for each fragment" min="1" + help="Minimu length of the read segment that needs to be mapped. clan_search parameter '-l'"/> + </when> + </conditional> + <param name="chimeric_overlap" type="integer" value="2" label=" Maximum number of bases allowed + between the chimericsegments of a read"/> + </inputs> + + <outputs> + <data format="bed" name="mapped_bed" from_work_dir="mapped.bed" label="ChiRA aligned BED on ${on_string}"/> + <data format="fasta" name="unmapped_fasta" from_work_dir="short.unmapped.fa" + label="ChiRA unmapped FASTA on ${on_string}"> + <filter>alignment['aligner'] == "bwa"</filter> + </data> + </outputs> + + <tests> + <!-- Test: Map with BWA-mem --> + <test expect_num_outputs="2"> + <param name="aligner" value="bwa"/> + <param name="query" value="reads.fasta"/> + <param name="ref_type" value="split"/> + <param name="ref_fasta1" value="ref1.fasta"/> + <param name="ref_fasta2" value="ref2.fasta"/> + <param name="unmapped" value="True"/> + <output name="mapped_bed" > + <assert_contents> + <has_text_matching expression="mmu-miR-6898-5p\t11\t21\t2|2,mmu-miR-6898-5p,11,21,+,10M39S\t0\t+" /> + </assert_contents> + </output> + <output name="unmapped_fasta" > + <assert_contents> + <has_text_matching expression="AAAAGACTCTGTAGACATGGCTGGTCTTGAACTCACAGAGATTTGTCTGCCTTTC" /> + </assert_contents> + </output> + </test> + <!-- Test: Map with CLAN --> + <test expect_num_outputs="1"> + <param name="aligner" value="clan"/> + <param name="query" value="reads.fasta"/> + <param name="ref_type" value="split"/> + <param name="ref_fasta1" value="ref1.fasta"/> + <param name="ref_fasta2" value="ref2.fasta"/> + <param name="unmapped" value="True"/> + <output name="mapped_bed" > + <assert_contents> + <has_text_matching expression="mmu-miR-20a-5p\t0\t23\t3|2,mmu-miR-20a-5p,0,23,+,5S23M27S\t0\t+" /> + </assert_contents> + </output> + </test> + </tests> + <help> + +.. class:: infomark + +**What it does** + +This tool handles the mapping of the reads to reference transcriptome. User can choose between the bwa-mem and CLAN alignment tools. + +**Inputs** + +* A fasta file containing reads +* A reference fasta file containing transcript sequences +* An optional second reference fasta file, incase if you split your reference into two + +**Output** + +* BED file containing the alignments +* Optional unmapped FASTA file + + </help> + <expand macro="citations" /> +</tool>
