Mercurial > repos > iuc > chewbbaca_allelecall
diff AlleleCall.xml @ 0:1ac58e449c87 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/chewbbaca commit 8bb518e20d68623904232ae28bb8a51ec05c1c4a
| author | iuc |
|---|---|
| date | Wed, 25 Sep 2024 14:12:27 +0000 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/AlleleCall.xml Wed Sep 25 14:12:27 2024 +0000 @@ -0,0 +1,222 @@ +<tool id="chewbbaca_allelecall" name="ChewBBACA AlleleCall" version="@CHEW_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> + <description>Determine the allelic profiles of a set of genomes</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <command detect_errors="exit_code"><![CDATA[ + #import re + mkdir 'input' && + mkdir 'schema' && + #for $file in $input_file + #set escaped_element_identifier = re.sub('[^\w\-]', '_', str($file.element_identifier)) + ln -sf '$file' 'input/${escaped_element_identifier}.${file.ext}' && + #end for + unzip '$input_schema' -d 'schema' && + chewBBACA.py AlleleCall + #if $training_file: + --ptf '$training_file' + #end if + $cds_input + #if $genes_list: + --gl '$genes_list' + #end if + #if str($blast_score_ratio) != "" + --bsr $blast_score_ratio + #end if + #if str($minimum_length) != "" + --l $minimum_length + #end if + #if str($translation_table) != "" + --t $translation_table + #end if + #if str($size_threshold) != "" + --st $size_threshold + #end if + $no_inferred + --pm $prodigal_mode + --mode $mode + --force-continue + #if 'output_unclassified' in $output_selector: + --output-unclassified + #end if + #if 'output_missing' in $output_selector: + --output-missing + #end if + #if 'output_novel' in $output_selector: + --output-novel + #end if + #if 'hash_profile' in $output_selector: + ## It can use any hashing algorithm from hashlib but for simplicity we set it to md5 + --hash-profile md5 + #end if + -i 'input' -g 'schema/schema_seed/' -o 'output' + ]]></command> + <inputs> + <param format="fasta" name="input_file" type="data" multiple="true" label="Genome assemblies in FASTA format"/> + <param format="zip" name="input_schema" type="data" label="Schema Files in zip format" help="The schema directory contains the loci FASTA files and a folder named 'short' that contains the FASTA files with the loci representative alleles."/> + <section name="advanced" title="Advanced options"> + <param argument="--genes-list" type="data" format="txt" label="Gene list" optional="true" /> + <param argument="--training-file" type="data" format="binary" label="Prodigal training file" optional="true" help="By default, gets the training file from the schema"/> + <param argument="--cds-input" type="boolean" truevalue="--cds-input" falsevalue="" checked="false" label="CDS input" optional="true"/> + <param argument="--blast-score-ratio" type="float" min="0.0" max="1.0" value="" optional="true" label="BLAST Score Ratio value" /> + <param argument="--minimum-length" type="integer" min="0" value="" optional="true" label="Minimum sequence length value"/> + <param argument="--translation-table" type="integer" min="0" value="" optional="true" help="Must match the genetic code used to create the training file (default: uses value defined in schema config)." label="Genetic code used to predict genes and to translate coding sequences"/> + <param argument="--size-threshold" type="float" min="0" value="" optional="true" label="CDS size variation threshold"/> + <param argument="--no-inferred" type="boolean" truevalue="--no-inferred" falsevalue="" checked="false" optional="true" label="Add the sequences of inferred alleles (INF) to the schema" help="Use this parameter if the schema is being accessed by multiple processes/users simultaneously." /> + <param argument="--prodigal-mode" type="select" optional="true" label="Prodigal Mode" help=""single" for finished genomes, reasonable quality draft genomes and big viruses. "meta" for metagenomes, low quality draft genomes, small viruses, and small plasmids"> + <option value="single" selected="true"> + single + </option> + <option value="meta"> + meta + </option> + </param> + <param argument="--mode" type="select" label="Execution mode" optional="true"> + <option value="1">Only exact matches at DNA level</option> + <option value="2">Exact matches at DNA and Protein level </option> + <option value="3">Exact matches and minimizer-based clustering to find similar alleles based on BSR+0.1 </option> + <option value="4" selected="true">Exact matches and minimizer-based clustering to find similar alleles based on BSR+0.1 </option> + </param> + </section> + <section name="output" title="Output Options"> + <param name="output_selector" type="select" multiple="true" optional="true" display="checkboxes" label="Select / Deselect all"> + <option value="output_unclassified">Create a Fasta file with unclassified coding sequences. (--output-unclassified)</option> + <option value="output_missing">Create a Fasta file with coding sequences classified as NIPH, NIPHEM, ASM, ALM, PLOT3, PLOT5 and LOTSC. (--output-missing)</option> + <option value="output_novel">Create Fasta file with the novel alleles inferred during the allele calling. (--output-novel)</option> + <option value="hash_profile">Create TSV file with hashed allelic profiles. (--hash-profile) </option> + </param> + </section> + </inputs> + <outputs> + <collection name="allelecall_results" type="list" label="${tool.name} on ${on_string}: AlleleCall Results"> + <discover_datasets pattern="(?P<name>.+)\.tsv$" format="tabular" directory="output"/> + </collection> + <collection name="allelcall_log" type="list" label="${tool.name} on ${on_string}: AlleleCall Logs"> + <discover_datasets pattern="(?P<name>.+)\.txt$" format="txt" directory="output"/> + </collection> + <data name="unclassified_fasta" format="fasta" from_work_dir="output/unclassified_sequences.fasta" label="${tool.name} on ${on_string}: Unclassified fasta"> + <filter>output['output_selector'] and 'output_unclassified' in output['output_selector']</filter> + </data> + <data name="missing_fasta" format="fasta" from_work_dir="output/missing_classes.fasta" label="${tool.name} on ${on_string}: Missing fasta"> + <filter>output['output_selector'] and 'output_missing' in output['output_selector']</filter> + </data> + <data name="novel_fasta" format="fasta" from_work_dir="output/novel_alleles.fasta" label="${tool.name} on ${on_string}: Novel fasta"> + <filter>output['output_selector'] and 'output_novel' in output['output_selector']</filter> + </data> + </outputs> + <tests> + <test expect_num_outputs="4"> + <param name="input_file" value="GCA_000007265"/> + <param name="input_schema" value="schema.zip"/> + <param name="output_selector" value="output_unclassified,output_missing,hash_profile" /> + <output_collection name="allelecall_results" type="list"> + <element name="cds_coordinates" file="cds_coordinates.tsv" compare="diff"/> + <element name="loci_summary_stats" file="loci_summary_stats.tsv" compare="diff"/> + <element name="paralogous_loci" ftype="tabular"> + <assert_contents> + <has_text_matching expression="Genome.*Loci.*CDS"/> + </assert_contents> + </element> + <element name="results_alleles" ftype="tabular"> + <assert_contents> + <has_text_matching expression="1.*1.*NIPHEM.*1.*1"/> + <has_text_matching expression="GCA_000007265.*1"/> + </assert_contents> + </element> + <element name="results_alleles" file="results_alleles.tsv" compare="diff"/> + <element name="results_alleles_hashed" ftype="tabular"> + <assert_contents> + <has_text_matching expression="FILE.*GCA-000007265-protein1.*GCA-000007265-protein10.*GCA-000007265-protein100"/> + <has_text_matching expression="GCA_000007265.*308e7666834338d0530d925b2737f2c6.*4aece26d201d59a90947e3400c7abf3f.*ebea148832aa2ae2704d37ebd5123169"/> + </assert_contents> + </element> + <element name="results_statistics" file="results_statistics.tsv" compare="diff"/> + </output_collection> + <output_collection name="allelcall_log" type="list"> + <element name="logging_info" ftype="txt"> + <assert_contents> + <has_text_matching expression="Used a BSR of: 0.6"/> + </assert_contents> + </element> + </output_collection> + <output name="unclassified_fasta"> + <assert_contents> + <has_text_matching expression="GCA_000007265-protein15"/> + <has_text_matching expression="ATGCACCACCTGTCACTTCTGCTCCGAAGAGAAAGCCTATCTCTAGGCCGGTCAGAAGGATGTCAAGACCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGCGTTAG"/> + </assert_contents> + </output> + <output name="missing_fasta"> + <assert_contents> + <has_text_matching expression="1|GCA_000007265|GCA-000007265-protein16&NIPHEM|GCA_000007265-protein16&EXC"/> + </assert_contents> + </output> + </test> + <test expect_num_outputs="4"> + <param name="input_file" value="GCA_000007265.fna"/> + <param name="input_schema" value="schema.zip"/> + <param name="output_selector" value="output_unclassified,output_missing,hash_profile" /> + <output_collection name="allelecall_results" type="list"> + <element name="paralogous_loci" ftype="tabular"> + <assert_contents> + <has_text_matching expression="Genome.*Loci.*CDS"/> + </assert_contents> + </element> + <element name="results_alleles" ftype="tabular"> + <assert_contents> + <has_text_matching expression="1.*1.*NIPHEM.*1.*1"/> + <has_text_matching expression="GCA_000007265.*1"/> + </assert_contents> + </element> + <element name="results_alleles_hashed" ftype="tabular"> + <assert_contents> + <has_text_matching expression="FILE.*GCA-000007265-protein1.*GCA-000007265-protein10.*GCA-000007265-protein100"/> + <has_text_matching expression="GCA_000007265_fna.*308e7666834338d0530d925b2737f2c6.*4aece26d201d59a90947e3400c7abf3f.*ebea148832aa2ae2704d37ebd5123169"/> + </assert_contents> + </element> + </output_collection> + <output_collection name="allelcall_log" type="list"> + <element name="logging_info" ftype="txt"> + <assert_contents> + <has_text_matching expression="Used a BSR of: 0.6"/> + </assert_contents> + </element> + </output_collection> + <output name="unclassified_fasta"> + <assert_contents> + <has_text_matching expression="GCA_000007265_fna-protein83"/> + <has_text_matching expression="ATGCACCACCTGTCACTTCTGCTCCGAAGAGAAAGCCTATCTCTAGGCCGGTCAGAAGGATGTCAAGACCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGCGTTAG"/> + </assert_contents> + </output> + <output name="missing_fasta"> + <assert_contents> + <has_text_matching expression="1|GCA_000007265|GCA-000007265-protein16&NIPHEM|GCA_000007265-protein16&EXC"/> + </assert_contents> + </output> + </test> + </tests> + <help> +chewBBACA is a software suite for the creation and evaluation of core genome and whole genome MultiLocus Sequence Typing (cg/wgMLST) schemas and results. + +In chewBBACA, by default, an allele needs to be a CDS defined by Prodigal_. To ensure reproducibility of the CDS prediction, the same Prodigal training file for each bacterial species should be used and provided as input. + +.. class:: infomark + +**Important** + +Although the use of a training file is optional, it is highly recommended to ensure consistent results. + +If the schema files are created by chewBBACA v2, please use the PrepExternalSchema module to convert the schema to a format fully compatible with chewBBACA v3. + +By default, the AlleleCall module uses the Prodigal training file included in the schema’s directory and it is not necessary to pass a training file to the --ptf parameter. + +.. class:: infomark + +**Note** + +If a text file that contains a list of full paths to loci FASTA files or loci IDs, one per line, is passed to the --genes-list parameter, the process will only perform allele calling for the loci in that list. + +.. _Prodigal: https://github.com/hyattpd/Prodigal + </help> + <expand macro="citations" /> +</tool> \ No newline at end of file