Mercurial > repos > iuc > bcftools_consensus
diff bcftools_consensus.xml @ 14:b0911dc4ad74 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bcftools commit 8ad854180e3be0934cdb1f0021886199a2edf9c3"
| author | iuc |
|---|---|
| date | Fri, 05 Feb 2021 19:14:54 +0000 |
| parents | f56a1a62cb12 |
| children | 703d87c2684c |
line wrap: on
line diff
--- a/bcftools_consensus.xml Wed Dec 25 17:06:14 2019 +0000 +++ b/bcftools_consensus.xml Fri Feb 05 19:14:54 2021 +0000 @@ -1,5 +1,5 @@ <?xml version='1.0' encoding='utf-8'?> -<tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@"> +<tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy1"> <description>Create consensus sequence by applying VCF variants to a reference fasta file</description> <macros> <token name="@EXECUTABLE@">consensus</token> @@ -34,6 +34,10 @@ #end if @SAMPLE@ +#set $section = $sec_restrict +@INCLUDE@ +@EXCLUDE@ + #if $chain: --chain '$chain_file' #end if @@ -64,6 +68,10 @@ </section> <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" /> <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" /> + <section name="sec_restrict" expanded="false" title="Restrict to"> + <expand macro="macro_include" /> + <expand macro="macro_exclude" /> + </section> </inputs> <outputs> <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/> @@ -119,6 +127,18 @@ </assert_contents> </output> </test> + <test> + <expand macro="test_using_reference" ref="consensus.fa" /> + <param name="input_file" ftype="vcf" value="consensus.vcf" /> + <section name="sec_restrict"> + <param name="include" value='TYPE="snp"' /> + </section> + <output name="output_file"> + <assert_contents> + <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" /> + </assert_contents> + </output> + </test> </tests> <help><