diff bcftools_consensus.xml @ 14:b0911dc4ad74 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bcftools commit 8ad854180e3be0934cdb1f0021886199a2edf9c3"
author iuc
date Fri, 05 Feb 2021 19:14:54 +0000
parents f56a1a62cb12
children 703d87c2684c
line wrap: on
line diff
--- a/bcftools_consensus.xml	Wed Dec 25 17:06:14 2019 +0000
+++ b/bcftools_consensus.xml	Fri Feb 05 19:14:54 2021 +0000
@@ -1,5 +1,5 @@
 <?xml version='1.0' encoding='utf-8'?>
-<tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@">
+<tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy1">
     <description>Create consensus sequence by applying VCF variants to a reference fasta file</description>
     <macros>
         <token name="@EXECUTABLE@">consensus</token>
@@ -34,6 +34,10 @@
 #end if
 @SAMPLE@
 
+#set $section = $sec_restrict
+@INCLUDE@
+@EXCLUDE@
+
 #if $chain:
   --chain '$chain_file'
 #end if
@@ -64,6 +68,10 @@
         </section>
         <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" />
         <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" />
+        <section name="sec_restrict" expanded="false" title="Restrict to">    
+            <expand macro="macro_include" />
+            <expand macro="macro_exclude" />
+        </section>
     </inputs>
     <outputs>
         <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/>
@@ -119,6 +127,18 @@
                 </assert_contents>
             </output>
         </test>
+        <test>
+            <expand macro="test_using_reference" ref="consensus.fa" />
+            <param name="input_file" ftype="vcf" value="consensus.vcf" />
+            <section name="sec_restrict">
+                <param name="include" value='TYPE="snp"' />
+            </section>
+            <output name="output_file">
+                <assert_contents>
+                    <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" />
+                </assert_contents>
+            </output>
+        </test>
     </tests>
     <help><![CDATA[
 =====================================