Mercurial > repos > iuc > bcftools_consensus
diff bcftools_consensus.xml @ 26:62ed6ee05b6f draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/bcftools commit f6efda26965eb73c9107d367fd5ffdf246ed0dbc
| author | iuc |
|---|---|
| date | Tue, 02 Dec 2025 07:57:56 +0000 |
| parents | 5970245e8525 |
| children |
line wrap: on
line diff
--- a/bcftools_consensus.xml Sun Aug 18 09:58:28 2024 +0000 +++ b/bcftools_consensus.xml Tue Dec 02 07:57:56 2025 +0000 @@ -1,136 +1,219 @@ -<?xml version='1.0' encoding='utf-8'?> <tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>Create consensus sequence by applying VCF variants to a reference fasta file</description> <macros> <token name="@EXECUTABLE@">consensus</token> <import>macros.xml</import> </macros> - <expand macro="bio_tools" /> + <expand macro="bio_tools"/> <expand macro="requirements"> <expand macro="samtools_requirement"/> - <requirement type="package" version="5.0.1">gawk</requirement> + <requirement type="package" version="5.3.0">gawk</requirement> </expand> - <expand macro="version_command" /> + <expand macro="version_command"/> <command detect_errors="aggressive"><![CDATA[ -@PREPARE_ENV@ @PREPARE_INPUT_FILE@ #set $section = $reference_source @PREPARE_FASTA_REF@ +#set $section = $sec_restrict +#if $section.regions.regions_src != '__none__': + samtools faidx + #if $section.regions.regions_src == 'regions': + #set $intervals = $section.regions.region_specs + @PARSE_INTERVALS@ + #set $ref_regions_spec = " ".join("'" + c + "'" for c in $components) + '$input_fa_ref' $ref_regions_spec | + #else if $section.regions.regions_src == 'regions_file': + -r '$section.regions.regions_file' '$input_fa_ref' | + #end if + #set $input_fa_ref = "-" +#end if + bcftools @EXECUTABLE@ +#if $section.regions.regions_src != '__none__': + --regions-overlap $section.regions_overlap +#end if + +#set $section = $reference_source @FASTA_REF@ -## Default section -#set $section = $sec_default - -${section.iupac_codes} - -#if $section.mask: - --mask '${section.mask}' +$mode.select +#if not str($mode.select): + $mode.specify_samples.how + #if str($mode.specify_samples.how) in ["-s", "-S"]: + '${mode.specify_samples.invert_samples}${mode.specify_samples.samples_spec}' + #end if +#else if str($mode.select) == "-H": + #if str(mode.haplotype.rule) in ["", "pIu"]: + #set haplotype_option = str(mode.haplotype.allele_n) + str(mode.haplotype.rule) + #else: + #set haplotype_option = str(mode.haplotype.rule) + #end if + $haplotype_option + #if $mode.sample: + --sample '$mode.sample' + #end if #end if -#if $section.mark_del - --mark-del '$section.mark_del' -#end if +#set $masks = [] +#for $m in $masking_options.mask: + #if $m: + #silent $masks.append($m) + #end if +#end for -#if $section.mark_ins - --mark-ins $section.mark_ins +#if $masks: + #if $masking_options.mask_with: + #set $masking_instructions = [] + #for $i in str($masking_options.mask_with).split(",", maxsplit=len($masks)-1): + #silent $masking_instructions.append("--mask-with '" + $i + "'") + #end for + #else: + #set $masking_instructions = [""] + #end if + #if len($masking_instructions) == 1: + ## use same masking instruction for all masks + #set $masking_instructions = [""] * (len($masks) - 1) + $masking_instructions + #else if len($masking_instructions) < len($masks): + ## fill in empty masking instructions for missing ones, which will make bcftools complain about them + #silent $masking_instructions.extend(["--mask-with ''"] * (len($masks) - len($masking_instructions))) + #end if + + #for $m, $i in zip($masks, $masking_instructions): + --mask '$m' $i + #end for #end if -#if $section.mark_snv - --mark-snv $section.mark_snv +#if $masking_options.absent: +--absent '$masking_options.absent' +#end if + +#if $masking_options.mark_del: + --mark-del '$masking_options.mark_del' #end if -#if $section.select_haplotype: - --haplotype '${section.select_haplotype}' +$masking_options.insertions.mark_ins +#if str($masking_options.insertions.mark_ins) == "--mark-ins": + '$masking_options.insertions.ins_custom' #end if -@SAMPLE@ + +$masking_options.snvs.mark_snv +#if str($masking_options.snvs.mark_snv) == "--mark-snv": + '$masking_options.snvs.snv_custom' +#end if #set $section = $sec_restrict @INCLUDE@ @EXCLUDE@ #if $chain: - --chain '$chain_file' -#end if - -#if $absent - --absent '$absent' + --chain '$chain_file' #end if ## Primary Input/Outputs #if str($rename) == "no" - --output '$output_file' + --output '$output_file' #end if @INPUT_FILE@ #if str($rename) == "yes": - #set basename=$input_file.element_identifier - | awk 'BEGIN {i=1} {if (match($0, /^>/)) {if (i==1) {name="${basename}"} else {name=sprintf("%s-%d","${basename}",i);} print(gensub(/>[^ ]+( ?.*)/, ">" name "\\1", 1)); i=i+1;} else {print}}' > '$output_file' + #set basename=$input_file.element_identifier + | awk 'BEGIN {i=1} {if (match($0, /^>/)) {if (i==1) {name="${basename}"} else {name=sprintf("%s-%d","${basename}",i);} print(gensub(/>[^ ]+( ?.*)/, ">" name "\\1", 1)); i=i+1;} else {print}}' > '$output_file' #end if ]]> </command> <inputs> - <expand macro="macro_input" /> - <expand macro="macro_fasta_ref" /> - <section name="sec_default" expanded="true" title="Default Options"> - <param name="mask" type="data" format="tabular" label="Mask" optional="True" help="Replace regions with N" /> - <param name="iupac_codes" type="boolean" truevalue="--iupac-codes" falsevalue="" label="Iupac Codes" - help="Output variants in the form of IUPAC ambiguity codes" /> - <expand macro="macro_sample" /> - <param name="select_haplotype" type="select" optional="true"> - <option value="1">1</option> - <option value="2">2</option> - </param> - <param argument="--mark-del" type="text" value="" optional="true" label="Mark deletions" help="Instead of removing sequence, insert CHAR for deletions"> - <sanitizer invalid_char=""> - <valid initial="string.letters,string.digits"> - <add value="_" /> - </valid> - </sanitizer> - <validator type="regex">[0-9a-zA-Z_]+</validator> + <expand macro="macro_input"/> + <expand macro="macro_fasta_ref"/> + <conditional name="mode"> + <param name="select" type="select" label="Consensus building mode; at each variant site ..."> + <option value="-s -">ignore any sample genotypes; incorporate first allele from ALT column (-s -)</option> + <option value="-I -s -">ignore any sample genotypes; incorporate IUPAC code representing all alleles from REF/ALT coulmns (-I -s -)</option> + <option value="" selected="true">incorporate IUPAC code representing the genotypes of all selected samples (default)</option> + <option value="-H">incorporate specific haplotype allele of one selected sample</option> </param> - <param argument="--mark-ins" type="select" optional="true" label="Mark insertions" help="Highlight insertions in uppercase (uc) or lowercase (lc), leaving the rest as is"> - <option value="uc">Uppercase</option> - <option value="lc">Lowercase</option> - </param> - <param argument="--mark-snv" type="select" optional="true" label="Mark substitutions" help="Highlight substitutions in uppercase (uc) or lowercase (lc), leaving the rest as is"> - <option value="uc">Uppercase</option> - <option value="lc">Lowercase</option> + <when value="-s -" /> + <when value="-I -s -" /> + <when value=""> + <expand macro="macro_samples_enhanced" /> + </when> + <when value="-H"> + <expand macro="macro_sample" help="The name of the single sample alleles of which should get used for the consensus sequence. This field is optional only if your input VCF dataset specifies exactly one sample."/> + <conditional name="haplotype"> + <param name="rule" type="select" label="From the selected sample's genotype use ...'"> + <option value="">the Nth allele (for both phased and unphased genotypes) (-H N)</option> + <option value="pIu">the Nth allele if the genotype is phased, the IUPAC code representing the genotype if it's unphased (-H NpIu)</option> + <option value="R">the ALT allele where the sample is homozygous, the REF allele otherwise (-H R)</option> + <option value="A">the ALT allele where the sample is homozygous or heterozygous (-H A)</option> + <option value="LR">the ALT allele where the sample is homozygous, the REF allele where it's heterozygous unless the ALT allele is longer (-H LR)</option> + <option value="LA">the ALT allele where the sample is homozygous, the ALT allele where it's heterozygous unless the REF allele is longer (-H LA)</option> + <option value="SR">the ALT allele where the sample is homozygous, the REF allele where it's heterozygous unless the ALT allele is shorter (-H SR</option> + <option value="SA">the ALT allele where the sample is homozygous, the ALT allele where it's heterozygous unless the REF allele is shorter (-H SA)</option> + </param> + <when value=""> + <param name="allele_n" type="integer" min="1" value="1" label="where N is" /> + </when> + <when value="pIu"> + <param name="allele_n" type="integer" min="1" value="1" label="where N is" /> + </when> + <when value="R" /> + <when value="A" /> + <when value="LR" /> + <when value="LA" /> + <when value="SR" /> + <when value="SA" /> + </conditional> + </when> + </conditional> + <section name="masking_options" expanded="false" title="Masking and marking options" help="The various options in this section are applied in the order they appear, i.e. 1) masking, 2) marking of absent sites, 3) SNV/indel marking."> + <param argument="--mask" type="data" format="tabular" multiple="true" optional="true" label="Mask" help="Replace regions according to the next --mask-with option"/> + <param argument="--mask-with" type="text" value="" optional="true" label="Mask with" help="Replace with CHAR (skips overlapping variants; default: N); use "uc" or "lc" to change to uppercase or lowercase, respectively. If you have provided more than one Mask dataset and you would like to apply a unique mask for the regions in each of them, then you can specify a comma-separated list of masking instructions (as many as mask datasets)." /> + <param argument="--absent" type="text" value="" optional="true" label="Mark absent" help="Replace reference bases at positions absent from the VCF input with a custom character."> + <validator type="regex">^.$</validator> </param> - <conditional name="conditional_mask"> - <param name="selector" type="select" label="Mask file option"> - <option value="disabled">Disabled</option> - <option value="enabled">Enabled</option> + <param argument="--mark-del" type="text" value="" optional="true" label="Mark deletions" help="Instead of removing the reference base at deleted positions, replace the base with a custom character."> + <validator type="regex">^.$</validator> + </param> + <conditional name="insertions"> + <param argument="--mark-ins" type="select" label="Mark insertions" help="Highlight insertions in uppercase or lowercase, or by using a fixed character instead of inserted bases, leaving the rest as is"> + <option value="">Do not mark insertions</option> + <option value="--mark-ins uc">Uppercase (uc)</option> + <option value="--mark-ins lc">Lowercase (lc)</option> + <option value="--mark-ins">Custom character</option> </param> - <when value="disabled"/> - <when value="enabled"> - <param argument="--mask" type="data" format="tabular" label="Mask" help="Replace regions according to the next --mask-with option" /> - <param argument="--mask-with" type="text" value="N" optional="true" label="Mask with" help="Replace with CHAR (skips overlapping variants); change to uppercase (uc) or lowercase (lc)"> - <sanitizer invalid_char=""> - <valid initial="string.letters,string.digits"> - <add value="_" /> - </valid> - </sanitizer> - <validator type="regex">[0-9a-zA-Z_]+</validator> + <when value="" /> + <when value="--mark-ins uc" /> + <when value="--mark-ins lc" /> + <when value="--mark-ins"> + <param name="ins_cutom" type="text" optional="false" label="Character to use instead of an inserted base"> + <validator type="empty_field"/> + </param> + </when> + </conditional> + <conditional name="snvs"> + <param argument="--mark-snv" type="select" label="Mark substitutions" help="Highlight substitutions in uppercase or lowercase, or by using a fixed character instead of substituted bases, leaving the rest as is"> + <option value="">Do not mark substitutions</option> + <option value="--mark-snv uc">Uppercase (uc)</option> + <option value="--mark-snv lc">Lowercase (lc)</option> + <option value="--mark-snv">Custom character</option> + </param> + <when value="" /> + <when value="--mark-snv uc" /> + <when value="--mark-snv lc" /> + <when value="--mark-snv"> + <param name="snv_custom" type="text" optional="false" label="Character to use instead of a subtituted base"> + <validator type="empty_field"/> </param> </when> </conditional> </section> - <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" /> - <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" /> - <param argument="--absent" type="text" value="" label="Absent" optional="true" help="It allows to set positions with no supporting evidence to N (or any other character)"> - <sanitizer invalid_char=""> - <valid initial="string.letters,string.digits,string.punctuation"> - <remove value="@" /> - <remove value="'" /> - </valid> - </sanitizer> - </param> - <section name="sec_restrict" expanded="false" title="Restrict to"> - <expand macro="macro_include" /> - <expand macro="macro_exclude" /> + <section name="sec_restrict" expanded="false" title="Restrict to"> + <expand macro="macro_include"/> + <expand macro="macro_exclude"/> + <expand macro="macro_region_restrict" label_select="Restrict consensus building to only specified regions of reference?"/> </section> + <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover"/> + <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF"/> </inputs> <outputs> <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/> @@ -140,103 +223,172 @@ </outputs> <tests> <test expect_num_outputs="2"> - <expand macro="test_using_reference" ref="consensus.fa" /> - <param name="input_file" ftype="vcf" value="consensus.vcf" /> - <param name="mask" ftype="tabular" value="consensus.tab" /> - <param name="chain" value="True" /> + <expand macro="test_using_reference" ref="consensus.fa"/> + <param name="input_file" ftype="vcf" value="consensus.vcf"/> + <section name="masking_options"> + <param name="mask" ftype="tabular" value="consensus.tab"/> + </section> + <param name="chain" value="true"/> <output name="output_file"> <assert_contents> - <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN" /> + <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN"/> </assert_contents> </output> <output name="chain_file"> <assert_contents> - <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1" /> + <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1"/> </assert_contents> </output> </test> <test expect_num_outputs="2"> - <expand macro="test_using_reference" select_from="cached" ref="consensus" /> - <param name="input_file" ftype="vcf" dbkey="?" value="consensus.vcf" /> - <param name="mask" ftype="tabular" value="consensus.tab" /> - <param name="chain" value="True" /> + <expand macro="test_using_reference" select_from="cached" ref="consensus"/> + <param name="input_file" ftype="vcf" dbkey="?" value="consensus.vcf"/> + <section name="masking_options"> + <param name="mask" ftype="tabular" value="consensus.tab"/> + </section> + <param name="chain" value="true"/> <output name="output_file"> <assert_contents> - <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN" /> + <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN"/> </assert_contents> </output> <output name="chain_file"> <assert_contents> - <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1" /> + <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1"/> </assert_contents> </output> </test> <test expect_num_outputs="1"> - <expand macro="test_using_reference" ref="consensus.fa" /> - <param name="input_file" ftype="vcf" value="consensus.vcf" /> - <param name="mask" ftype="tabular" value="consensus.tab" /> - <param name="chain" value="False" /> - <param name="rename" value="True" /> + <expand macro="test_using_reference" ref="consensus.fa"/> + <param name="input_file" ftype="vcf" value="consensus.vcf"/> + <section name="masking_options"> + <param name="mask" ftype="tabular" value="consensus.tab"/> + </section> + <param name="chain" value="false"/> + <param name="rename" value="true"/> <output name="output_file"> <assert_contents> - <has_text text=">consensus.vcf" /> + <has_text text=">consensus.vcf"/> </assert_contents> <assert_contents> - <has_text text=">consensus.vcf-2" /> + <has_text text=">consensus.vcf-2"/> </assert_contents> </output> </test> <test expect_num_outputs="1"> - <expand macro="test_using_reference" ref="consensus.fa" /> - <param name="input_file" ftype="vcf" value="consensus.vcf" /> + <expand macro="test_using_reference" ref="consensus.fa"/> + <param name="input_file" ftype="vcf" value="consensus.vcf"/> + <conditional name="mode"> + <param name="select" value="-s -"/> + </conditional> <section name="sec_restrict"> - <param name="include" value='TYPE="snp"' /> + <param name="include" value="TYPE="snp""/> </section> <output name="output_file"> <assert_contents> - <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" /> + <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA"/> </assert_contents> </output> </test> <!--Test absent option--> <test expect_num_outputs="1"> - <expand macro="test_using_reference" ref="consensus.fa" /> - <param name="input_file" ftype="vcf" value="consensus.vcf" /> + <expand macro="test_using_reference" ref="consensus.fa"/> + <param name="input_file" ftype="vcf" value="consensus.vcf"/> + <conditional name="mode"> + <param name="select" value="-s -"/> + </conditional> + <section name="masking_options"> + <param name="absent" value="W"/> + </section> <section name="sec_restrict"> - <param name="include" value='TYPE="snp"' /> + <param name="include" value="TYPE="snp""/> </section> - <param name="absent" value="W"/> <output name="output_file"> <assert_contents> - <has_text text="WWWAWAWWAWWWWWWWWCWWWWWWWW" /> + <has_text text="WWWAWAWWAWWWWWWWWCWWWWWWWW"/> + </assert_contents> + </output> + <assert_command> + <has_text text="--absent"/> + </assert_command> + </test> + <test expect_num_outputs="1"> + <expand macro="test_using_reference" ref="consensus.fa"/> + <param name="input_file" ftype="vcf" value="consensus.vcf"/> + <conditional name="mode"> + <param name="select" value="-s -"/> + </conditional> + <section name="masking_options"> + <param name="mark_del" value="-"/> + <conditional name="insertions"> + <param name="mark_ins" value="--mark-ins uc"/> + </conditional> + <conditional name="snvs"> + <param name="mark_snv" value="--mark-snv uc"/> + </conditional> + </section> + <section name="sec_restrict"> + <param name="include" value="TYPE="snp""/> + </section> + <output name="output_file"> + <assert_contents> + <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA"/> </assert_contents> </output> <assert_command> - <has_text text="--absent" /> + <has_text text="--mark-del"/> + <has_text text="--mark-ins"/> + <has_text text="--mark-snv"/> </assert_command> </test> - <!--Test mask options --> <test expect_num_outputs="1"> - <expand macro="test_using_reference" ref="consensus.fa" /> - <param name="input_file" ftype="vcf" value="consensus.vcf" /> + <expand macro="test_using_reference" ref="csq.fa"/> + <param name="input_file" ftype="vcf" value="csq.vcf"/> + <section name="masking_options"> + <param name="absent" value="."/> + <param name="mark_del" value="-"/> + </section> <section name="sec_restrict"> - <param name="include" value='TYPE="snp"' /> - </section> - <section name="sec_default"> - <param name="mark_del" value="DEL"/> - <param name="mark_ins" value="uc"/> - <param name="mark_snv" value="uc"/> + <conditional name="regions"> + <param name="regions_src" value="regions"/> + <repeat name="region_specs"> + <param name="chrom" value="1"/> + <param name="start" value="161"/> + <param name="stop" value="190"/> + </repeat> + </conditional> </section> <output name="output_file"> <assert_contents> - <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" /> + <has_line line=">1:161-190"/> + <has_line line="-............................Y"/> </assert_contents> </output> - <assert_command> - <has_text text="--mark-del" /> - <has_text text="--mark-ins" /> - <has_text text="--mark-snv" /> - </assert_command> + </test> + <test expect_num_outputs="1"> + <expand macro="test_using_reference" ref="csq.fa"/> + <param name="input_file" ftype="vcf" value="csq.vcf"/> + <section name="masking_options"> + <param name="absent" value="."/> + <param name="mark_del" value="-"/> + </section> + <section name="sec_restrict"> + <conditional name="regions"> + <param name="regions_src" value="regions"/> + <repeat name="region_specs"> + <param name="chrom" value="1"/> + <param name="start" value="161"/> + <param name="stop" value="190"/> + </repeat> + <param name="regions_overlap" value="0"/> + </conditional> + </section> + <output name="output_file"> + <assert_contents> + <has_line line=">1:161-190"/> + <has_line line=".............................Y"/> + </assert_contents> + </output> </test> </tests> <help><![CDATA[ @@ -249,7 +401,7 @@ @BCFTOOLS_MANPAGE@#@EXECUTABLE@ -@BCFTOOLS_WIKI@ +@BCFTOOLS_HOWTOS@ The option to set the new consensus' FASTA ID from the name of the VCF is provided by post-processing the bcftools consensus output. It is primarily intended for use when the VCF is coming from a list @@ -258,5 +410,5 @@ alignment to a phylogeny program. ]]> </help> - <expand macro="citations" /> + <expand macro="citations"/> </tool>