Mercurial > repos > iuc > bcftools_consensus

comparison bcftools_consensus.xml @ 26:62ed6ee05b6f draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/bcftools commit f6efda26965eb73c9107d367fd5ffdf246ed0dbc
author iuc
date Tue, 02 Dec 2025 07:57:56 +0000
parents 5970245e8525
children
comparison
equal deleted inserted replaced
25:411b66c55cf9 26:62ed6ee05b6f
1 <?xml version='1.0' encoding='utf-8'?>
2 <tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> 1 <tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
3 <description>Create consensus sequence by applying VCF variants to a reference fasta file</description> 2 <description>Create consensus sequence by applying VCF variants to a reference fasta file</description>
4 <macros> 3 <macros>
5 <token name="@EXECUTABLE@">consensus</token> 4 <token name="@EXECUTABLE@">consensus</token>
6 <import>macros.xml</import> 5 <import>macros.xml</import>
7 </macros> 6 </macros>
8 <expand macro="bio_tools" /> 7 <expand macro="bio_tools"/>
9 <expand macro="requirements"> 8 <expand macro="requirements">
10 <expand macro="samtools_requirement"/> 9 <expand macro="samtools_requirement"/>
11 <requirement type="package" version="5.0.1">gawk</requirement> 10 <requirement type="package" version="5.3.0">gawk</requirement>
12 </expand> 11 </expand>
13 <expand macro="version_command" /> 12 <expand macro="version_command"/>
14 <command detect_errors="aggressive"><![CDATA[ 13 <command detect_errors="aggressive"><![CDATA[
15 @PREPARE_ENV@
16 @PREPARE_INPUT_FILE@ 14 @PREPARE_INPUT_FILE@
17 #set $section = $reference_source 15 #set $section = $reference_source
18 @PREPARE_FASTA_REF@ 16 @PREPARE_FASTA_REF@
19 17
18 #set $section = $sec_restrict
19 #if $section.regions.regions_src != '__none__':
20 samtools faidx
21 #if $section.regions.regions_src == 'regions':
22 #set $intervals = $section.regions.region_specs
23 @PARSE_INTERVALS@
24 #set $ref_regions_spec = " ".join("'" + c + "'" for c in $components)
25 '$input_fa_ref' $ref_regions_spec |
26 #else if $section.regions.regions_src == 'regions_file':
27 -r '$section.regions.regions_file' '$input_fa_ref' |
28 #end if
29 #set $input_fa_ref = "-"
30 #end if
31
20 bcftools @EXECUTABLE@ 32 bcftools @EXECUTABLE@
21 33
34 #if $section.regions.regions_src != '__none__':
35 --regions-overlap $section.regions_overlap
36 #end if
37
38 #set $section = $reference_source
22 @FASTA_REF@ 39 @FASTA_REF@
23 40
24 ## Default section 41 $mode.select
25 #set $section = $sec_default 42 #if not str($mode.select):
26 43 $mode.specify_samples.how
27 ${section.iupac_codes} 44 #if str($mode.specify_samples.how) in ["-s", "-S"]:
28 45 '${mode.specify_samples.invert_samples}${mode.specify_samples.samples_spec}'
29 #if $section.mask: 46 #end if
30 --mask '${section.mask}' 47 #else if str($mode.select) == "-H":
31 #end if 48 #if str(mode.haplotype.rule) in ["", "pIu"]:
32 49 #set haplotype_option = str(mode.haplotype.allele_n) + str(mode.haplotype.rule)
33 #if $section.mark_del 50 #else:
34 --mark-del '$section.mark_del' 51 #set haplotype_option = str(mode.haplotype.rule)
35 #end if 52 #end if
36 53 $haplotype_option
37 #if $section.mark_ins 54 #if $mode.sample:
38 --mark-ins $section.mark_ins 55 --sample '$mode.sample'
39 #end if 56 #end if
40 57 #end if
41 #if $section.mark_snv 58
42 --mark-snv $section.mark_snv 59 #set $masks = []
43 #end if 60 #for $m in $masking_options.mask:
44 61 #if $m:
45 #if $section.select_haplotype: 62 #silent $masks.append($m)
46 --haplotype '${section.select_haplotype}' 63 #end if
47 #end if 64 #end for
48 @SAMPLE@ 65
66 #if $masks:
67 #if $masking_options.mask_with:
68 #set $masking_instructions = []
69 #for $i in str($masking_options.mask_with).split(",", maxsplit=len($masks)-1):
70 #silent $masking_instructions.append("--mask-with '" + $i + "'")
71 #end for
72 #else:
73 #set $masking_instructions = [""]
74 #end if
75 #if len($masking_instructions) == 1:
76 ## use same masking instruction for all masks
77 #set $masking_instructions = [""] * (len($masks) - 1) + $masking_instructions
78 #else if len($masking_instructions) < len($masks):
79 ## fill in empty masking instructions for missing ones, which will make bcftools complain about them
80 #silent $masking_instructions.extend(["--mask-with ''"] * (len($masks) - len($masking_instructions)))
81 #end if
82
83 #for $m, $i in zip($masks, $masking_instructions):
84 --mask '$m' $i
85 #end for
86 #end if
87
88 #if $masking_options.absent:
89 --absent '$masking_options.absent'
90 #end if
91
92 #if $masking_options.mark_del:
93 --mark-del '$masking_options.mark_del'
94 #end if
95
96 $masking_options.insertions.mark_ins
97 #if str($masking_options.insertions.mark_ins) == "--mark-ins":
98 '$masking_options.insertions.ins_custom'
99 #end if
100
101 $masking_options.snvs.mark_snv
102 #if str($masking_options.snvs.mark_snv) == "--mark-snv":
103 '$masking_options.snvs.snv_custom'
104 #end if
49 105
50 #set $section = $sec_restrict 106 #set $section = $sec_restrict
51 @INCLUDE@ 107 @INCLUDE@
52 @EXCLUDE@ 108 @EXCLUDE@
53 109
54 #if $chain: 110 #if $chain:
55 --chain '$chain_file' 111 --chain '$chain_file'
56 #end if
57
58 #if $absent
59 --absent '$absent'
60 #end if 112 #end if
61 113
62 ## Primary Input/Outputs 114 ## Primary Input/Outputs
63 #if str($rename) == "no" 115 #if str($rename) == "no"
64 --output '$output_file' 116 --output '$output_file'
65 #end if 117 #end if
66 @INPUT_FILE@ 118 @INPUT_FILE@
67 #if str($rename) == "yes": 119 #if str($rename) == "yes":
68 #set basename=$input_file.element_identifier 120 #set basename=$input_file.element_identifier
69 | awk 'BEGIN {i=1} {if (match($0, /^>/)) {if (i==1) {name="${basename}"} else {name=sprintf("%s-%d","${basename}",i);} print(gensub(/>[^ ]+( ?.*)/, ">" name "\\1", 1)); i=i+1;} else {print}}' > '$output_file' 121 | awk 'BEGIN {i=1} {if (match($0, /^>/)) {if (i==1) {name="${basename}"} else {name=sprintf("%s-%d","${basename}",i);} print(gensub(/>[^ ]+( ?.*)/, ">" name "\\1", 1)); i=i+1;} else {print}}' > '$output_file'
70 #end if 122 #end if
71 ]]> 123 ]]>
72 </command> 124 </command>
73 <inputs> 125 <inputs>
74 <expand macro="macro_input" /> 126 <expand macro="macro_input"/>
75 <expand macro="macro_fasta_ref" /> 127 <expand macro="macro_fasta_ref"/>
76 <section name="sec_default" expanded="true" title="Default Options"> 128 <conditional name="mode">
77 <param name="mask" type="data" format="tabular" label="Mask" optional="True" help="Replace regions with N" /> 129 <param name="select" type="select" label="Consensus building mode; at each variant site ...">
78 <param name="iupac_codes" type="boolean" truevalue="--iupac-codes" falsevalue="" label="Iupac Codes" 130 <option value="-s -">ignore any sample genotypes; incorporate first allele from ALT column (-s -)</option>
79 help="Output variants in the form of IUPAC ambiguity codes" /> 131 <option value="-I -s -">ignore any sample genotypes; incorporate IUPAC code representing all alleles from REF/ALT coulmns (-I -s -)</option>
80 <expand macro="macro_sample" /> 132 <option value="" selected="true">incorporate IUPAC code representing the genotypes of all selected samples (default)</option>
81 <param name="select_haplotype" type="select" optional="true"> 133 <option value="-H">incorporate specific haplotype allele of one selected sample</option>
82 <option value="1">1</option>
83 <option value="2">2</option>
84 </param> 134 </param>
85 <param argument="--mark-del" type="text" value="" optional="true" label="Mark deletions" help="Instead of removing sequence, insert CHAR for deletions"> 135 <when value="-s -" />
86 <sanitizer invalid_char=""> 136 <when value="-I -s -" />
87 <valid initial="string.letters,string.digits"> 137 <when value="">
88 <add value="_" /> 138 <expand macro="macro_samples_enhanced" />
89 </valid> 139 </when>
90 </sanitizer> 140 <when value="-H">
91 <validator type="regex">[0-9a-zA-Z_]+</validator> 141 <expand macro="macro_sample" help="The name of the single sample alleles of which should get used for the consensus sequence. This field is optional only if your input VCF dataset specifies exactly one sample."/>
142 <conditional name="haplotype">
143 <param name="rule" type="select" label="From the selected sample's genotype use ...'">
144 <option value="">the Nth allele (for both phased and unphased genotypes) (-H N)</option>
145 <option value="pIu">the Nth allele if the genotype is phased, the IUPAC code representing the genotype if it's unphased (-H NpIu)</option>
146 <option value="R">the ALT allele where the sample is homozygous, the REF allele otherwise (-H R)</option>
147 <option value="A">the ALT allele where the sample is homozygous or heterozygous (-H A)</option>
148 <option value="LR">the ALT allele where the sample is homozygous, the REF allele where it's heterozygous unless the ALT allele is longer (-H LR)</option>
149 <option value="LA">the ALT allele where the sample is homozygous, the ALT allele where it's heterozygous unless the REF allele is longer (-H LA)</option>
150 <option value="SR">the ALT allele where the sample is homozygous, the REF allele where it's heterozygous unless the ALT allele is shorter (-H SR</option>
151 <option value="SA">the ALT allele where the sample is homozygous, the ALT allele where it's heterozygous unless the REF allele is shorter (-H SA)</option>
152 </param>
153 <when value="">
154 <param name="allele_n" type="integer" min="1" value="1" label="where N is" />
155 </when>
156 <when value="pIu">
157 <param name="allele_n" type="integer" min="1" value="1" label="where N is" />
158 </when>
159 <when value="R" />
160 <when value="A" />
161 <when value="LR" />
162 <when value="LA" />
163 <when value="SR" />
164 <when value="SA" />
165 </conditional>
166 </when>
167 </conditional>
168 <section name="masking_options" expanded="false" title="Masking and marking options" help="The various options in this section are applied in the order they appear, i.e. 1) masking, 2) marking of absent sites, 3) SNV/indel marking.">
169 <param argument="--mask" type="data" format="tabular" multiple="true" optional="true" label="Mask" help="Replace regions according to the next --mask-with option"/>
170 <param argument="--mask-with" type="text" value="" optional="true" label="Mask with" help="Replace with CHAR (skips overlapping variants; default: N); use &quot;uc&quot; or &quot;lc&quot; to change to uppercase or lowercase, respectively. If you have provided more than one Mask dataset and you would like to apply a unique mask for the regions in each of them, then you can specify a comma-separated list of masking instructions (as many as mask datasets)." />
171 <param argument="--absent" type="text" value="" optional="true" label="Mark absent" help="Replace reference bases at positions absent from the VCF input with a custom character.">
172 <validator type="regex">^.$</validator>
92 </param> 173 </param>
93 <param argument="--mark-ins" type="select" optional="true" label="Mark insertions" help="Highlight insertions in uppercase (uc) or lowercase (lc), leaving the rest as is"> 174 <param argument="--mark-del" type="text" value="" optional="true" label="Mark deletions" help="Instead of removing the reference base at deleted positions, replace the base with a custom character.">
94 <option value="uc">Uppercase</option> 175 <validator type="regex">^.$</validator>
95 <option value="lc">Lowercase</option>
96 </param> 176 </param>
97 <param argument="--mark-snv" type="select" optional="true" label="Mark substitutions" help="Highlight substitutions in uppercase (uc) or lowercase (lc), leaving the rest as is"> 177 <conditional name="insertions">
98 <option value="uc">Uppercase</option> 178 <param argument="--mark-ins" type="select" label="Mark insertions" help="Highlight insertions in uppercase or lowercase, or by using a fixed character instead of inserted bases, leaving the rest as is">
99 <option value="lc">Lowercase</option> 179 <option value="">Do not mark insertions</option>
100 </param> 180 <option value="--mark-ins uc">Uppercase (uc)</option>
101 <conditional name="conditional_mask"> 181 <option value="--mark-ins lc">Lowercase (lc)</option>
102 <param name="selector" type="select" label="Mask file option"> 182 <option value="--mark-ins">Custom character</option>
103 <option value="disabled">Disabled</option>
104 <option value="enabled">Enabled</option>
105 </param> 183 </param>
106 <when value="disabled"/> 184 <when value="" />
107 <when value="enabled"> 185 <when value="--mark-ins uc" />
108 <param argument="--mask" type="data" format="tabular" label="Mask" help="Replace regions according to the next --mask-with option" /> 186 <when value="--mark-ins lc" />
109 <param argument="--mask-with" type="text" value="N" optional="true" label="Mask with" help="Replace with CHAR (skips overlapping variants); change to uppercase (uc) or lowercase (lc)"> 187 <when value="--mark-ins">
110 <sanitizer invalid_char=""> 188 <param name="ins_cutom" type="text" optional="false" label="Character to use instead of an inserted base">
111 <valid initial="string.letters,string.digits"> 189 <validator type="empty_field"/>
112 <add value="_" /> 190 </param>
113 </valid> 191 </when>
114 </sanitizer> 192 </conditional>
115 <validator type="regex">[0-9a-zA-Z_]+</validator> 193 <conditional name="snvs">
194 <param argument="--mark-snv" type="select" label="Mark substitutions" help="Highlight substitutions in uppercase or lowercase, or by using a fixed character instead of substituted bases, leaving the rest as is">
195 <option value="">Do not mark substitutions</option>
196 <option value="--mark-snv uc">Uppercase (uc)</option>
197 <option value="--mark-snv lc">Lowercase (lc)</option>
198 <option value="--mark-snv">Custom character</option>
199 </param>
200 <when value="" />
201 <when value="--mark-snv uc" />
202 <when value="--mark-snv lc" />
203 <when value="--mark-snv">
204 <param name="snv_custom" type="text" optional="false" label="Character to use instead of a subtituted base">
205 <validator type="empty_field"/>
116 </param> 206 </param>
117 </when> 207 </when>
118 </conditional> 208 </conditional>
119 </section> 209 </section>
120 <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" /> 210 <section name="sec_restrict" expanded="false" title="Restrict to">
121 <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" /> 211 <expand macro="macro_include"/>
122 <param argument="--absent" type="text" value="" label="Absent" optional="true" help="It allows to set positions with no supporting evidence to N (or any other character)"> 212 <expand macro="macro_exclude"/>
123 <sanitizer invalid_char=""> 213 <expand macro="macro_region_restrict" label_select="Restrict consensus building to only specified regions of reference?"/>
124 <valid initial="string.letters,string.digits,string.punctuation">
125 <remove value="@" />
126 <remove value="'" />
127 </valid>
128 </sanitizer>
129 </param>
130 <section name="sec_restrict" expanded="false" title="Restrict to">
131 <expand macro="macro_include" />
132 <expand macro="macro_exclude" />
133 </section> 214 </section>
215 <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover"/>
216 <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF"/>
134 </inputs> 217 </inputs>
135 <outputs> 218 <outputs>
136 <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/> 219 <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/>
137 <data name="chain_file" format="txt" label="${tool.name} on ${on_string}: chain"> 220 <data name="chain_file" format="txt" label="${tool.name} on ${on_string}: chain">
138 <filter>chain</filter> 221 <filter>chain</filter>
139 </data> 222 </data>
140 </outputs> 223 </outputs>
141 <tests> 224 <tests>
142 <test expect_num_outputs="2"> 225 <test expect_num_outputs="2">
143 <expand macro="test_using_reference" ref="consensus.fa" /> 226 <expand macro="test_using_reference" ref="consensus.fa"/>
144 <param name="input_file" ftype="vcf" value="consensus.vcf" /> 227 <param name="input_file" ftype="vcf" value="consensus.vcf"/>
145 <param name="mask" ftype="tabular" value="consensus.tab" /> 228 <section name="masking_options">
146 <param name="chain" value="True" /> 229 <param name="mask" ftype="tabular" value="consensus.tab"/>
147 <output name="output_file"> 230 </section>
148 <assert_contents> 231 <param name="chain" value="true"/>
149 <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN" /> 232 <output name="output_file">
233 <assert_contents>
234 <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN"/>
150 </assert_contents> 235 </assert_contents>
151 </output> 236 </output>
152 <output name="chain_file"> 237 <output name="chain_file">
153 <assert_contents> 238 <assert_contents>
154 <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1" /> 239 <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1"/>
155 </assert_contents> 240 </assert_contents>
156 </output> 241 </output>
157 </test> 242 </test>
158 <test expect_num_outputs="2"> 243 <test expect_num_outputs="2">
159 <expand macro="test_using_reference" select_from="cached" ref="consensus" /> 244 <expand macro="test_using_reference" select_from="cached" ref="consensus"/>
160 <param name="input_file" ftype="vcf" dbkey="?" value="consensus.vcf" /> 245 <param name="input_file" ftype="vcf" dbkey="?" value="consensus.vcf"/>
161 <param name="mask" ftype="tabular" value="consensus.tab" /> 246 <section name="masking_options">
162 <param name="chain" value="True" /> 247 <param name="mask" ftype="tabular" value="consensus.tab"/>
163 <output name="output_file"> 248 </section>
164 <assert_contents> 249 <param name="chain" value="true"/>
165 <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN" /> 250 <output name="output_file">
251 <assert_contents>
252 <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN"/>
166 </assert_contents> 253 </assert_contents>
167 </output> 254 </output>
168 <output name="chain_file"> 255 <output name="chain_file">
169 <assert_contents> 256 <assert_contents>
170 <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1" /> 257 <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1"/>
171 </assert_contents> 258 </assert_contents>
172 </output> 259 </output>
173 </test> 260 </test>
174 <test expect_num_outputs="1"> 261 <test expect_num_outputs="1">
175 <expand macro="test_using_reference" ref="consensus.fa" /> 262 <expand macro="test_using_reference" ref="consensus.fa"/>
176 <param name="input_file" ftype="vcf" value="consensus.vcf" /> 263 <param name="input_file" ftype="vcf" value="consensus.vcf"/>
177 <param name="mask" ftype="tabular" value="consensus.tab" /> 264 <section name="masking_options">
178 <param name="chain" value="False" /> 265 <param name="mask" ftype="tabular" value="consensus.tab"/>
179 <param name="rename" value="True" /> 266 </section>
180 <output name="output_file"> 267 <param name="chain" value="false"/>
181 <assert_contents> 268 <param name="rename" value="true"/>
182 <has_text text=">consensus.vcf" /> 269 <output name="output_file">
183 </assert_contents> 270 <assert_contents>
184 <assert_contents> 271 <has_text text="&gt;consensus.vcf"/>
185 <has_text text=">consensus.vcf-2" /> 272 </assert_contents>
186 </assert_contents> 273 <assert_contents>
187 </output> 274 <has_text text="&gt;consensus.vcf-2"/>
188 </test> 275 </assert_contents>
189 <test expect_num_outputs="1"> 276 </output>
190 <expand macro="test_using_reference" ref="consensus.fa" /> 277 </test>
191 <param name="input_file" ftype="vcf" value="consensus.vcf" /> 278 <test expect_num_outputs="1">
279 <expand macro="test_using_reference" ref="consensus.fa"/>
280 <param name="input_file" ftype="vcf" value="consensus.vcf"/>
281 <conditional name="mode">
282 <param name="select" value="-s -"/>
283 </conditional>
192 <section name="sec_restrict"> 284 <section name="sec_restrict">
193 <param name="include" value='TYPE="snp"' /> 285 <param name="include" value="TYPE=&quot;snp&quot;"/>
194 </section> 286 </section>
195 <output name="output_file"> 287 <output name="output_file">
196 <assert_contents> 288 <assert_contents>
197 <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" /> 289 <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA"/>
198 </assert_contents> 290 </assert_contents>
199 </output> 291 </output>
200 </test> 292 </test>
201 <!--Test absent option--> 293 <!--Test absent option-->
202 <test expect_num_outputs="1"> 294 <test expect_num_outputs="1">
203 <expand macro="test_using_reference" ref="consensus.fa" /> 295 <expand macro="test_using_reference" ref="consensus.fa"/>
204 <param name="input_file" ftype="vcf" value="consensus.vcf" /> 296 <param name="input_file" ftype="vcf" value="consensus.vcf"/>
297 <conditional name="mode">
298 <param name="select" value="-s -"/>
299 </conditional>
300 <section name="masking_options">
301 <param name="absent" value="W"/>
302 </section>
205 <section name="sec_restrict"> 303 <section name="sec_restrict">
206 <param name="include" value='TYPE="snp"' /> 304 <param name="include" value="TYPE=&quot;snp&quot;"/>
207 </section> 305 </section>
208 <param name="absent" value="W"/> 306 <output name="output_file">
209 <output name="output_file"> 307 <assert_contents>
210 <assert_contents> 308 <has_text text="WWWAWAWWAWWWWWWWWCWWWWWWWW"/>
211 <has_text text="WWWAWAWWAWWWWWWWWCWWWWWWWW" />
212 </assert_contents> 309 </assert_contents>
213 </output> 310 </output>
214 <assert_command> 311 <assert_command>
215 <has_text text="--absent" /> 312 <has_text text="--absent"/>
216 </assert_command> 313 </assert_command>
217 </test> 314 </test>
218 <!--Test mask options --> 315 <test expect_num_outputs="1">
219 <test expect_num_outputs="1"> 316 <expand macro="test_using_reference" ref="consensus.fa"/>
220 <expand macro="test_using_reference" ref="consensus.fa" /> 317 <param name="input_file" ftype="vcf" value="consensus.vcf"/>
221 <param name="input_file" ftype="vcf" value="consensus.vcf" /> 318 <conditional name="mode">
319 <param name="select" value="-s -"/>
320 </conditional>
321 <section name="masking_options">
322 <param name="mark_del" value="-"/>
323 <conditional name="insertions">
324 <param name="mark_ins" value="--mark-ins uc"/>
325 </conditional>
326 <conditional name="snvs">
327 <param name="mark_snv" value="--mark-snv uc"/>
328 </conditional>
329 </section>
222 <section name="sec_restrict"> 330 <section name="sec_restrict">
223 <param name="include" value='TYPE="snp"' /> 331 <param name="include" value="TYPE=&quot;snp&quot;"/>
224 </section> 332 </section>
225 <section name="sec_default"> 333 <output name="output_file">
226 <param name="mark_del" value="DEL"/> 334 <assert_contents>
227 <param name="mark_ins" value="uc"/> 335 <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA"/>
228 <param name="mark_snv" value="uc"/>
229 </section>
230 <output name="output_file">
231 <assert_contents>
232 <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" />
233 </assert_contents> 336 </assert_contents>
234 </output> 337 </output>
235 <assert_command> 338 <assert_command>
236 <has_text text="--mark-del" /> 339 <has_text text="--mark-del"/>
237 <has_text text="--mark-ins" /> 340 <has_text text="--mark-ins"/>
238 <has_text text="--mark-snv" /> 341 <has_text text="--mark-snv"/>
239 </assert_command> 342 </assert_command>
343 </test>
344 <test expect_num_outputs="1">
345 <expand macro="test_using_reference" ref="csq.fa"/>
346 <param name="input_file" ftype="vcf" value="csq.vcf"/>
347 <section name="masking_options">
348 <param name="absent" value="."/>
349 <param name="mark_del" value="-"/>
350 </section>
351 <section name="sec_restrict">
352 <conditional name="regions">
353 <param name="regions_src" value="regions"/>
354 <repeat name="region_specs">
355 <param name="chrom" value="1"/>
356 <param name="start" value="161"/>
357 <param name="stop" value="190"/>
358 </repeat>
359 </conditional>
360 </section>
361 <output name="output_file">
362 <assert_contents>
363 <has_line line="&gt;1:161-190"/>
364 <has_line line="-............................Y"/>
365 </assert_contents>
366 </output>
367 </test>
368 <test expect_num_outputs="1">
369 <expand macro="test_using_reference" ref="csq.fa"/>
370 <param name="input_file" ftype="vcf" value="csq.vcf"/>
371 <section name="masking_options">
372 <param name="absent" value="."/>
373 <param name="mark_del" value="-"/>
374 </section>
375 <section name="sec_restrict">
376 <conditional name="regions">
377 <param name="regions_src" value="regions"/>
378 <repeat name="region_specs">
379 <param name="chrom" value="1"/>
380 <param name="start" value="161"/>
381 <param name="stop" value="190"/>
382 </repeat>
383 <param name="regions_overlap" value="0"/>
384 </conditional>
385 </section>
386 <output name="output_file">
387 <assert_contents>
388 <has_line line="&gt;1:161-190"/>
389 <has_line line=".............................Y"/>
390 </assert_contents>
391 </output>
240 </test> 392 </test>
241 </tests> 393 </tests>
242 <help><![CDATA[ 394 <help><![CDATA[
243 ===================================== 395 =====================================
244 bcftools @EXECUTABLE@ plugin 396 bcftools @EXECUTABLE@ plugin
247 399
248 Create consensus sequence by applying VCF variants to a reference fasta file. 400 Create consensus sequence by applying VCF variants to a reference fasta file.
249 401
250 @BCFTOOLS_MANPAGE@#@EXECUTABLE@ 402 @BCFTOOLS_MANPAGE@#@EXECUTABLE@
251 403
252 @BCFTOOLS_WIKI@ 404 @BCFTOOLS_HOWTOS@
253 405
254 The option to set the new consensus' FASTA ID from the name of the VCF is provided by post-processing 406 The option to set the new consensus' FASTA ID from the name of the VCF is provided by post-processing
255 the bcftools consensus output. It is primarily intended for use when the VCF is coming from a list 407 the bcftools consensus output. It is primarily intended for use when the VCF is coming from a list
256 collection where the elements of the list are named meaningfully (e.g. named after sample names). This 408 collection where the elements of the list are named meaningfully (e.g. named after sample names). This
257 is useful when consensus sequences are being prepared for, for example, feeding a multiple sequence 409 is useful when consensus sequences are being prepared for, for example, feeding a multiple sequence
258 alignment to a phylogeny program. 410 alignment to a phylogeny program.
259 ]]> 411 ]]>
260 </help> 412 </help>
261 <expand macro="citations" /> 413 <expand macro="citations"/>
262 </tool> 414 </tool>