Mercurial > repos > greg > multigps

changeset 51:4c5540844bb3 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author greg
date Wed, 05 Sep 2018 08:54:21 -0400
parents 20687c85887e
children
files .shed.yml README.rst macros.xml multigps.xml test-data/cntrl_hg19.scidx test-data/exclude_file.txt test-data/expt_hg19.scidx test-data/hg19_all_events_table1.tabular test-data/hg19_all_events_table2.tabular test-data/hg19_experiment_events1.tabular test-data/hg19_experiment_events2.tabular test-data/hg19_output_bed1.bed test-data/hg19_output_bed2.bed test-data/hg19_output_html1.html test-data/hg19_output_html2.html test-data/hg19_replicates_counts1.tabular test-data/hg19_replicates_counts2.tabular test-data/output_html1.html test-data/output_process1.txt test-data/phiX.fasta test-data/reb1_chipexo.distrib.tabular test-data/sacCer3_1.scidx
diffstat 22 files changed, 500 insertions(+), 496 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/.shed.yml	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,13 @@
+name: multigps
+owner: greg
+description: Analyzes collections of multi-condition ChIP-seq data.
+homepage_url: http://mahonylab.org/software/multigps/
+long_description: |
+  Contains a tool that runs MultiGPS, a framework for analyzing collections of multi-condition ChIP-seq
+  datasets and characterizing differential binding events between conditions.  MultiGPS encourages consistency
+  in the reported binding event locations across conditions and provides accurate estimation of ChIP enrichment
+  levels at each event.  MultiGPS loads all data to memory, so you will need a lot of available memory if you
+  are running analysis over many conditions or large datasets.
+type: unrestricted
+categories:
+- ChIP-seq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/README.rst	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,17 @@
+MultiGPS wrapper for Galaxy
+================================
+
+* http://mahonylab.org/software/multigps/
+
+MultiGPS performs significant EM optimization of binding events along the genome and across experimental
+conditions, and it integrates motif-finding via MEME.  The tool loads all data into memory, so the potential
+exists for time and memory intensive analyses if running over many conditions or large datasets.
+
+Setting the memory allocation in Galaxy for this tool is handled using the <env id="_JAVA_OPTIONS"> tag for
+a selected job runner in the job_conf.xml file.
+
+License
+-------
+
+MIT
+
--- a/macros.xml	Mon Mar 06 09:17:58 2017 -0500
+++ b/macros.xml	Wed Sep 05 08:54:21 2018 -0400
@@ -5,4 +5,23 @@
         <param name="mememinw" type="integer" min="0" value="6" label="Minimum motif width for MEME" />
         <param name="mememaxw" type="integer" min="0" value="16" label="Maximum motif width for MEME" />
     </xml>
+    <xml name="param_experiment_type">
+        <param name="experiment_type" type="select" display="radio" label="Experiment type for this replicate">
+            <option value="chipseq" selected="True">ChIP-seq</option>
+            <option value="chipexo">ChIP-exo</option>
+        </param>
+    </xml>
+    <xml name="cond_fixedreadcount">
+        <conditional name="fixedreadcount_cond">
+            <param  name="fixedreadcount_select" type="select" label="Set fixed per-base read count limit for this replicate?" help="Selecting No uses a global per-base limit that is estimated from a Poisson distribution.">
+                <option value="no" selected="True">No</option>
+                <option value="yes">Yes</option>
+            </param>
+            <when value="no"/>
+            <when value="yes">
+                <param name="fixedreadcount" type="integer" value="0" min="0" label="Fixed per-base read count limit"/>
+            </when>
+        </conditional>
+    </xml>
 </macros>
+
--- a/multigps.xml	Mon Mar 06 09:17:58 2017 -0500
+++ b/multigps.xml	Wed Sep 05 08:54:21 2018 -0400
@@ -1,10 +1,10 @@
-<tool id="multigps" name="MultiGPS" version="0.73.0">
+<tool id="multigps" name="MultiGPS" version="0.74.0">
     <description>analyzes collections of multi-condition ChIP-seq data</description>
     <macros>
         <import>macros.xml</import>
     </macros>
     <requirements>
-        <requirement type="package" version="0.73">multigps</requirement>
+        <requirement type="package" version="0.74">multigps</requirement>
     </requirements>
     <command detect_errors="aggressive">
         <![CDATA[
@@ -12,19 +12,14 @@
             mkdir -p $output_dir &&
             multigps
             ## General options
+            --design '$build_design_file'
             ## Append .txt extensions to events hrefs
             ## in output dataset so files will render
             ## in the browser.
             --eventsaretxt
-            ## Do not run the parallel version of meme
-            ## since it is not yet available in conda.
+            ## Do not run the parallel version of meme.
             --meme1proc
-            --expt '$expt'
-            --format $expt.ext
-            #if str($ctrl) != 'None':
-                --ctrl '$ctrl'
-            #end if
-            --threads=\${GALAXY_SLOTS:-4}
+            --threads \${GALAXY_SLOTS:-4}
             --geninfo '$chromInfo'
             ## Advanced options
             #set aoc = $advanced_options_cond
@@ -37,12 +32,12 @@
                 #set umc = $aoc.use_motif_cond
                 #if str($umc.use_motif) == 'yes':
                     #set rgc = $umc.reference_genome_cond
+                    --seq
                     #if str($rgc.reference_genome_source) == 'cached':
-                        #set seq = $rgc.reference_genome.fields.path
+                        '${rgc.reference_genome.fields.path}'
                     #else:
-                        #set seq = $rgc.reference_genome
+                        '${rgc.reference_genome}'
                     #end if
-                    --seq '$seq'
                 #end if
                 ## Limits on how many reads
                 #if str($rloc.reads_limits) == 'yes':
@@ -80,9 +75,9 @@
                 #end if
                 ## Running MultiGPS
                 #if str($aoc.readdistributionfile) != 'None':
-                    --d '$aoc.readdistributionfile'
+                    --readdistributionfile '$aoc.readdistributionfile'
                 #end if
-                --r $aoc.maxtrainingrounds
+                --maxtrainingrounds $aoc.maxtrainingrounds
                 #if str($aoc.nomodelupdate) == 'no':
                     --nomodelupdate
                 #end if
@@ -127,20 +122,20 @@
                             --mememinw $bmc.mememinw
                             --mememaxw $bmc.mememaxw
                         #else:
-                            #set mfoc = $bmc.nomotifprior_cond
+                            #set nmpc = $bmc.nomotifprior_cond
                             --nomotifs
-                            --nomotifprior $mfoc.nomotifprior
-                            #if str($mfoc.nomotifprior) == 'yes':
-                                --memenmotifs $mfoc.memenmotifs
-                                --mememinw $mfoc.mememinw
-                                --mememaxw $mfoc.mememaxw
+                            #if str($nmpc.nomotifprior) == 'yes':
+                                --nomotifprior
+                                --memenmotifs $nmpc.memenmotifs
+                                --mememinw $nmpc.mememinw
+                                --mememaxw $nmpc.mememaxw
                             #end if
                         #end if
                     #end if
                 #end if
                 ## Reporting binding events
                 #if str($rbec.report_binding_events) == 'yes':
-                    --q $rbec.minqvalue
+                    --minqvalue $rbec.minqvalue
                     --minfold $rbec.minfold
                     #if str($rbec.nodifftests) == 'no':
                         --nodifftests
@@ -149,19 +144,78 @@
                     --diffp $rbec.diffp
                 #end if
             #end if
-            >/dev/null
+            2>&1
             --out '$output_html.files_path'
-            && cp $output_dir/*.events.txt '$experiment_events' || true
-            && mv $output_dir/*.html '$output_html' || true
-            && mv $output_dir/*.table.txt '$all_events_table' || true
-            && mv $output_dir/*.counts '$replicates_counts' || true
+            #if str($save_design_file) == 'yes':
+                && cp '$build_design_file' '$output_design_file'
+            #end if
+            && mv $output_dir/*.counts '$replicates_counts'
+            && mv $output_dir/*.bed '$output_bed'
+            && mv $output_dir/*.html '$output_html'
+            && mv $output_dir/*.table.txt '$all_events_table'
         ]]>
     </command>
+    <configfiles>
+        <configfile name="build_design_file"><![CDATA[#for $condition_items in $condition_repeat:
+    #for $signal_items in $condition_items.signal_repeat:
+        #if str($signal_items.fixedreadcount_cond.fixedreadcount_select) == 'yes':
+            #set $frc = $signal_items.fixedreadcount_cond.fixedreadcount
+        #else:
+            #set $frc = ''
+        #end if
+${signal_items.signal}	Signal	${signal_items.signal.ext.upper()}	${condition_items.condition_name}	${signal_items.replicate_name}	${condition_items.experiment_type}	${frc}
+    #end for
+    #for $control_items in $condition_items.control_repeat:
+        #if str($control_items.specify_replicate_name_cond.specify_replicate_name) == 'yes':
+            #set $rn = $control_items.specify_replicate_name_cond.replicate_name
+        #else:
+            #set $rn = ''
+        #end if
+        #if str($control_items.fixedreadcount_cond.fixedreadcount_select) == 'yes':
+            #set $frc = $control_items.fixedreadcount_cond.fixedreadcount
+        #else:
+            #set $frc = ''
+        #end if
+${control_items.control}	Control	${control_items.control.ext.upper()}	${condition_items.condition_name}	${rn}	${condition_items.experiment_type}	${frc}
+    #end for
+#end for ]]></configfile>
+    </configfiles>
     <inputs>
-        <param name="expt" type="data" format="bam,bed,scidx" label="Run MultiGPS on">
-            <validator type="unspecified_build" />
+        <repeat name="condition_repeat" title="Condition" min="1">
+            <param name="condition_name" type="text" value="cond" label="Condition name">
+                <validator type="empty_field" />
+            </param>
+            <expand macro="param_experiment_type" />
+            <repeat name="signal_repeat" title="Signal" min="1">
+                <param name="signal" type="data" format="bam,bed,scidx" label="Select signal" help="Supported formats are bam, bed and scidx">
+                    <validator type="unspecified_build" />
+                </param>
+                <param name="replicate_name" type="text" value="1" label="Replicate name">
+                    <validator type="empty_field" />
+                </param>
+                <expand macro="cond_fixedreadcount" />
+            </repeat>
+            <repeat name="control_repeat" title="Control" min="0">
+                <param name="control" type="data" format="bam,bed,scidx" label="Select control" help="Optional, supported formats are bam, bed and scidx">
+                    <validator type="unspecified_build" />
+                </param>
+                <conditional name="specify_replicate_name_cond">
+                    <param  name="specify_replicate_name" type="select" label="Specify replicate name?" help="Optional for control.  If used, the control will only be used for the corresponding named signal replicate">
+                        <option value="no" selected="True">No</option>
+                        <option value="yes">Yes</option>
+                    </param>
+                    <when value="yes">
+                        <param name="replicate_name" type="text" optional="true" label="Replicate name"/>
+                    </when>
+                    <when value="no" />
+                </conditional>
+                <expand macro="cond_fixedreadcount" />
+            </repeat>
+        </repeat>
+        <param name="save_design_file" type="select" display="radio" label="Output design file?">
+            <option value="no" selected="true">No</option>
+            <option value="yes">Yes</option>
         </param>
-        <param name="ctrl" type="data" format="bam,bed,scidx" optional="True" label="Optional file containing reads from a control experiment" help="Must be same forat as the input above" />
         <!-- Advanced options -->
         <conditional name="advanced_options_cond">
             <param name="advanced_options" type="select" label="Advanced options">
@@ -192,7 +246,7 @@
                 </conditional>
                 <!-- Scaling data -->
                 <conditional name="scale_data_cond">
-                    <param  name="scale_data" type="select" label="Set data scaling parameters?" help="Default behavior is to scale signal to corresponding controls using regression on the set of signal/control ratios in 10Kbp windows.">
+                    <param  name="scale_data" type="select" label="Set data scaling parameters?" help="Default behavior is to scale signal to corresponding controls using the Normalization of ChIP-seq (NCIS) method.[2]">
                         <option value="no" selected="True">No</option>
                         <option value="yes">Yes</option>
                     </param>
@@ -282,7 +336,7 @@
                             <when value="cached">
                                 <param name="reference_genome" type="select" label="Using reference genome">
                                     <options from_data_table="all_fasta">
-                                        <filter type="data_meta" key="dbkey" ref="expt" column="1"/>
+                                        <!-- <filter type="data_meta" key="dbkey" ref="expt" column="1"/> does not yet work in a repeat...-->
                                     </options>
                                     <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
                                 </param>
@@ -290,7 +344,7 @@
                             <when value="history">
                                 <param name="reference_genome" type="data" format="fasta" label="Using reference genome">
                                     <options>
-                                        <filter type="data_meta" key="dbkey" ref="expt"/>
+                                        <!-- <filter type="data_meta" key="dbkey" ref="expt"/> does not yet work in a repeat...-->
                                     </options>
                                     <validator type="no_options" message="The current history does not include a fasta dataset with the build associated with the selected input file"/>
                                 </param>
@@ -358,24 +412,39 @@
         </conditional>
     </inputs>
     <outputs>
-        <data name="replicates_counts" format="tabular" label="${tool.name} replicates counts on ${on_string}"/>
-        <data name="all_events_table" format="tabular" label="${tool.name} all events table on ${on_string}"/>
-        <data name="experiment_events" format="tabular" label="${tool.name} experiment events on ${on_string}"/>
-        <data name="output_html" format="html" label="${tool.name} on ${on_string}"/>
+        <data name="output_design_file" format="tabular" label="${tool.name} (design file) on ${on_string}">
+            <filter>save_design_file == 'yes'</filter>
+        </data>
+        <data name="output_bed" format="bed" label="${tool.name} (bed) on ${on_string}"/>
+        <data name="output_html" format="html" label="${tool.name} (html) on ${on_string}"/>
+        <data name="replicates_counts" format="tabular" label="${tool.name} (replicates counts) on ${on_string}"/>
+        <data name="all_events_table" format="tabular" label="${tool.name} (all events table) on ${on_string}"/>
     </outputs>
     <tests>
         <test>
-            <param name="expt" value="expt_hg19.scidx" ftype="scidx" dbkey="hg19" />
-            <param name="advanced_options_cond" value="hide" />
-            <output name="output_html" file="hg19_output_html1.html" ftype="html" lines_diff="12"/>
+            <repeat name="condition_repeat">
+                <repeat name="signal_repeat">
+                    <param name="signal" value="expt_hg19.scidx" ftype="scidx" dbkey="hg19" />
+                </repeat>
+            </repeat>
+            <param name="advanced_options" value="hide" />
+            <output name="output_html" file="hg19_output_html1.html" ftype="html" compare="contains"/>
+            <output name="output_bed" file="hg19_output_bed1.bed" ftype="bed"/>
             <output name="all_events_table" file="hg19_all_events_table1.tabular" ftype="tabular"/>
             <output name="replicates_counts" file="hg19_replicates_counts1.tabular" ftype="tabular"/>
         </test>
         <test>
-            <param name="expt" value="expt_hg19.scidx" ftype="bam" dbkey="hg19" />
-            <param name="ctrl" value="cntrl_hg19.scidx" ftype="bam" dbkey="hg19" />
-            <param name="advanced_options_cond" value="display" />
-            <output name="output_html" file="hg19_output_html2.html" ftype="html" lines_diff="12"/>
+            <repeat name="condition_repeat">
+                <repeat name="signal_repeat">
+                    <param name="signal" value="expt_hg19.scidx" ftype="scidx" dbkey="hg19" />
+                </repeat>
+                <repeat name="control_repeat">
+                    <param name="control" value="cntrl_hg19.scidx" ftype="scidx" dbkey="hg19" />
+                </repeat>
+            </repeat>
+            <param name="advanced_options" value="display" />
+            <output name="output_html" file="hg19_output_html2.html" ftype="html" compare="contains"/>
+            <output name="output_bed" file="hg19_output_bed2.bed" ftype="bed"/>
             <output name="all_events_table" file="hg19_all_events_table2.tabular" ftype="tabular"/>
             <output name="replicates_counts" file="hg19_replicates_counts2.tabular" ftype="tabular"/>
         </test>
@@ -387,8 +456,9 @@
 MultiGPS is a framework for analyzing collections of multi-condition ChIP-seq datasets and characterizing
 differential binding events between conditions.  MultiGPS encourages consistency in the reported binding
 event locations across conditions and provides accurate estimation of ChIP enrichment levels at each event.
-MultiGPS loads all data to memory, so you will need a lot of available memory if you are running analysis
-over many conditions or large datasets.
+MultiGPS performs significant EM optimization of binding events along the genome and across experimental
+conditions, and it integrates motif-finding via MEME.  The tool loads all data into memory, so the potential
+exists for time and memory intensive analyses if running over many conditions or large datasets.
 
 -----
 
@@ -396,7 +466,7 @@
 
 * **Loading data:**
 
- - **Optional file containing reads from a control experiment** - must be same format as input experiment
+ - **Optional file containing reads from a control experiment** - file containing reads from a control experiment
  - **Fixed per-base limit** - Fixed per-base limit (default: estimated from background model).
  - **Poisson threshold for filtering per base** - Look at neighboring positions to decide what the per-base limit should be.
  - **Use non-unique reads** - Use non-unique reads.
@@ -450,6 +520,23 @@
 
     </help>
     <citations>
-        <citation type="doi">10.1371/journal.pcbi.1003501</citation>
+        <citation type="bibtex">
+            @article{Mahony2014,
+            journal = {PLOS Computational Biology},
+            author = {1. Mahony S, Edwards MD, Mazzoni EO, Sherwood RI, Kakumanu A, Morrison CA, Wichterle H, Gifford DK},
+            title = {An Integrated Model of Multiple-Condition ChIP-Seq Data Reveals Predeterminants of Cdx2 Binding},
+            year = {2014},}
+            volume = {10},
+            number = {3},
+            pages = {e1003501},}
+        </citation>
+        <citation type="bibtex">
+            @article{Liang2012,
+            journal = {BMC Bioinformatics},
+            author = {2. Liang, Ketes},
+            title = {Normalization of ChIP-seq data with control},
+            year = {2012},}
+        </citation>
     </citations>
 </tool>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cntrl_hg19.scidx	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,20 @@
+#2016-11-04 08:39:36.449;localbam.bam;READ1
+chrom	index	forward	reverse	value
+chr1	13038	1	0	1
+chr1	16604	0	1	1
+chr1	19215	1	0	1
+chr1	20151	0	1	1
+chr1	48908	1	0	1
+chr1	49489	1	0	1
+chr1	55105	1	0	1
+chr1	57499	0	1	1
+chr1	66636	1	0	1
+chr1	67393	0	1	1
+chr1	72875	0	1	1
+chr1	73954	0	1	1
+chr1	82146	1	0	1
+chr1	85089	0	1	1
+chr1	101405	1	0	1
+chr1	106851	0	1	1
+chr1	108358	0	1	1
+chr1	113877	0	1	1
--- a/test-data/exclude_file.txt	Mon Mar 06 09:17:58 2017 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,19 +0,0 @@
-chrM:1-16299
-chrUn_random:2612635-5900358
-chr2:98502275-98507644
-chr4:70039119-70039374
-chr6:103599051-103599300
-chr9:2999747-3039282
-chr9:24346417-24346673
-chr9:35112714-35113200
-chr12:3109856-3110140
-chr15:74916289-74917568
-chr17:39978367-39992180
-chr17:13498782-13499104
-chr18:3004587-3011375
-chr18:40467612-40468123
-chr18:43135589-43135697
-chrX:73843909-73844533
-chrX:139917541-139917665
-chrX:166406859-166448047
-
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/expt_hg19.scidx	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,101 @@
+#2016-11-04 08:39:36.449;localbam.bam;READ1
+chrom	index	forward	reverse	value
+chr1	13038	1	0	1
+chr1	16604	0	1	1
+chr1	19215	1	0	1
+chr1	20151	0	1	1
+chr1	48908	1	0	1
+chr1	49489	1	0	1
+chr1	55105	1	0	1
+chr1	57499	0	1	1
+chr1	66636	1	0	1
+chr1	67393	0	1	1
+chr1	72875	0	1	1
+chr1	73954	0	1	1
+chr1	82146	1	0	1
+chr1	85089	0	1	1
+chr1	101405	1	0	1
+chr1	106851	0	1	1
+chr1	108358	0	1	1
+chr1	113877	0	1	1
+chr1	122833	1	0	1
+chr1	123101	0	1	1
+chr1	124863	1	0	1
+chr1	125216	0	1	1
+chr1	139373	0	1	1
+chr1	150551	1	0	1
+chr1	158113	1	0	1
+chr1	160681	1	0	1
+chr1	167381	1	0	1
+chr1	173325	0	1	1
+chr1	234394	1	0	1
+chr1	234434	0	1	1
+chr1	235111	1	0	1
+chr1	236086	0	1	1
+chr1	236159	1	0	1
+chr1	237302	0	1	1
+chr1	237648	1	0	1
+chr1	237735	1	0	1
+chr1	238867	0	1	1
+chr1	240339	1	0	1
+chr1	250472	1	0	1
+chr1	250560	0	1	1
+chr1	252828	1	0	1
+chr1	255896	1	0	1
+chr1	258157	1	0	1
+chr1	354230	0	1	1
+chr1	521482	0	1	1
+chr1	523810	0	1	1
+chr1	526070	0	1	1
+chr1	526303	1	0	1
+chr1	526406	1	0	1
+chr1	527103	0	1	1
+chr1	527586	1	0	1
+chr1	527590	1	0	1
+chr1	527599	1	0	1
+chr1	530330	1	0	1
+chr1	532712	0	1	1
+chr1	534863	0	1	1
+chr1	535107	1	0	1
+chr1	535662	1	0	1
+chr1	535998	1	0	1
+chr1	537647	0	1	1
+chr1	539496	1	0	1
+chr1	540024	0	1	1
+chr1	540628	1	0	1
+chr1	542424	1	0	1
+chr1	544024	0	1	1
+chr1	546672	1	0	1
+chr1	549581	0	1	1
+chr1	562709	1	0	1
+chr1	563545	0	1	1
+chr1	566222	0	1	1
+chr1	566375	0	1	1
+chr1	566736	1	0	1
+chr1	566863	1	0	1
+chr1	566974	1	0	1
+chr1	568430	0	1	1
+chr1	568570	1	0	1
+chr1	569236	0	1	1
+chr1	569310	0	1	1
+chr1	569499	1	0	1
+chr1	569640	1	0	1
+chr1	569752	1	0	1
+chr1	569823	1	0	1
+chr1	569890	1	0	1
+chr1	569902	1	0	1
+chr1	569912	1	0	1
+chr1	569914	1	0	1
+chr1	569917	1	0	1
+chr1	569931	0	1	1
+chr1	569942	0	1	1
+chr1	569954	0	1	1
+chr1	569960	0	1	1
+chr1	569961	0	1	1
+chr1	569963	0	1	1
+chr1	570032	0	1	1
+chr1	570109	1	0	1
+chr1	570164	0	1	1
+chr1	570169	1	0	1
+chr1	570177	0	1	1
+chr1	570226	0	1	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_all_events_table1.tabular	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,31 @@
+### MultiGPS output
+#Condition	Name	Index	TotalSigCount	SignalFraction
+#Condition	cond	0	99.0	0.555
+#Replicate	ParentCond	Name	Index	SigCount	CtrlCount	SigCtrlScaling	SignalFraction
+#Replicate	cond	cond:1	0	99.0	0	1	0.56
+#
+#Point	cond_Sig	cond_Ctrl	cond_log2Fold	cond_log2P	ActiveConds
+chr1:569927	14.3	0.0	3.838	-6.470	1
+chr1:536042	1.0	0.0	0.014	-1.474	1
+chr1:535151	1.0	0.0	0.014	-1.413	1
+chr1:534819	1.0	0.0	0.014	-1.348	1
+chr1:539540	1.0	0.0	0.024	-1.281	1
+chr1:539980	1.0	0.0	0.024	-1.211	1
+chr1:125172	1.0	0.0	0.033	-1.137	1
+chr1:49533	1.0	0.0	0.036	-1.059	1
+chr1:67349	1.0	0.0	0.041	-0.976	1
+chr1:563501	1.0	0.0	0.043	-0.889	1
+chr1:20107	1.0	0.0	0.046	-0.796	1
+chr1:568610	1.8	0.0	0.853	-0.696	1
+chr1:237754	2.0	0.0	1.015	-0.626	1
+chr1:236192	2.0	0.0	0.973	-0.589	1
+chr1:569214	2.0	0.0	0.989	-0.474	1
+chr1:569652	2.0	0.0	1.016	-0.433	1
+chr1:566215	2.0	0.0	0.991	-0.348	1
+chr1:234414	2.0	0.0	1.020	-0.211	1
+chr1:122967	2.0	0.0	0.996	-0.211	1
+chr1:570152	4.6	0.0	2.207	-0.100	1
+chr1:250516	2.0	0.0	0.998	-0.059	1
+chr1:527636	3.0	0.0	1.608	0.000	1
+chr1:566984	2.9	0.0	1.560	0.000	1
+chr1:526421	2.0	0.0	1.021	0.000	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_all_events_table2.tabular	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,31 @@
+### MultiGPS output
+#Condition	Name	Index	TotalSigCount	SignalFraction
+#Condition	cond	0	99.0	0.555
+#Replicate	ParentCond	Name	Index	SigCount	CtrlCount	SigCtrlScaling	SignalFraction
+#Replicate	cond	cond:1	0	99.0	18.0	4.00	0.555
+#
+#Point	cond_Sig	cond_Ctrl	cond_log2Fold	cond_log2P	ActiveConds
+chr1:569927	14.3	0.0	3.838	-6.470	1
+chr1:536042	1.0	0.0	0.014	-1.281	1
+chr1:535151	1.0	0.0	0.014	-1.211	1
+chr1:534819	1.0	0.0	0.014	-1.137	1
+chr1:539540	1.0	0.0	0.024	-1.059	1
+chr1:539980	1.0	0.0	0.024	-0.976	1
+chr1:125172	1.0	0.0	0.033	-0.889	1
+chr1:563501	1.0	0.0	0.043	-0.796	1
+chr1:568610	1.8	0.0	0.853	-0.696	1
+chr1:237754	2.0	0.0	1.015	-0.626	1
+chr1:236192	2.0	0.0	0.973	-0.589	1
+chr1:569214	2.0	0.0	0.989	-0.474	1
+chr1:569652	2.0	0.0	1.016	-0.433	1
+chr1:566215	2.0	0.0	0.991	-0.348	1
+chr1:234414	2.0	0.0	1.020	-0.211	1
+chr1:122967	2.0	0.0	0.996	-0.211	1
+chr1:570152	4.6	0.0	2.207	-0.100	1
+chr1:250516	2.0	0.0	0.998	-0.059	1
+chr1:49533	1.0	1.0	-2.000	-0.006	1
+chr1:527636	3.0	0.0	1.608	0.000	1
+chr1:566984	2.9	0.0	1.560	0.000	1
+chr1:526421	2.0	0.0	1.021	0.000	1
+chr1:20107	1.0	1.0	-2.000	0.000	1
+chr1:67349	1.0	1.0	-2.000	0.000	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_experiment_events1.tabular	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,7 @@
+### MultiGPS output
+#Condition	Name	Index	TotalSigCount	SignalFraction
+#Condition	experiment	0	99.0	0.555
+#Replicate	ParentCond	Name	Index	SigCount	CtrlCount	CtrlScaling	SignalFraction
+#Replicate	experiment	experiment:rep1	0	99.0	0	1	0.555
+#
+#Point	experiment_Sig	experiment_Ctrl	experiment_log2Fold	experiment_log2P	Sequence	MotifScore
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_experiment_events2.tabular	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,7 @@
+### MultiGPS output
+#Condition	Name	Index	TotalSigCount	SignalFraction
+#Condition	experiment	0	99.0	0.555
+#Replicate	ParentCond	Name	Index	SigCount	CtrlCount	CtrlScaling	SignalFraction
+#Replicate	experiment	experiment:rep1	0	99.0	18.0	4.000	0.555
+#
+#Point	experiment_Sig	experiment_Ctrl	experiment_log2Fold	experiment_log2P	Sequence	MotifScore
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_output_bed1.bed	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,1 @@
+track name=multiGPS-cond description=multiGPS events cond
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_output_bed2.bed	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,1 @@
+track name=multiGPS-cond description=multiGPS events cond
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_output_html1.html	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,33 @@
+<html>
+	<body>
+	<h1>MultiGPS results (dataset_3_files)</h1>
+	<h2>Binding events</h2>
+	<table>
+		<tr>		<th>Condition</th>
+		<th>Events</th>
+		<th>File</th>
+		</tr>
+		<tr>		<td>cond</td>
+		<td>0</td>
+		<td><a href='dataset_3_files_cond.events.txt'>dataset_3_files_cond.events.txt</a></td>
+		</tr>
+	</table>
+	<h2>Input data</h2>
+	<table>
+		<tr>		<th>Replicate</th>
+		<th>ReadCount</th>
+		<th>CtrlScaling</th>
+		<th>SignalFraction</th>
+		<th>ReadDistributionModel</th>
+		</tr>
+		<tr>		<td>cond 1</td>
+		<td>99.0</td>
+		<td>NA</td>
+		<td>0.555</td>
+		<td><a href='#' onclick='return fullpopitup("images/dataset_3_files_cond-1_Read_Distributions.png")'><img src='images/dataset_3_files_cond-1_Read_Distributions.png' height='300'></a></td>
+		</tr>
+	</table>
+	<h2>Miscellaneous files</h2>
+	<p><a href='intermediate-results/dataset_3_files.intraCondPeakDistances.histo.txt'>Peak-peak distance histograms (same condition)</a></p>
+	</body>
+</html>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_output_html2.html	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,34 @@
+<html>
+	<head><title>MultiGPS results (dataset_9_files)</title></head>
+	<body>
+	<h1>MultiGPS results (dataset_9_files)</h1>
+	<h2>Binding events</h2>
+	<table>
+		<tr>		<th>Condition</th>
+		<th>Events</th>
+		<th>File</th>
+		</tr>
+		<tr>		<td>cond</td>
+		<td>0</td>
+		<td><a href='dataset_9_files_cond.events.txt'>dataset_9_files_cond.events.txt</a></td>
+		</tr>
+	</table>
+	<h2>Input data</h2>
+	<table>
+		<tr>		<th>Replicate</th>
+		<th>ReadCount</th>
+		<th>CtrlScaling</th>
+		<th>SignalFraction</th>
+		<th>ReadDistributionModel</th>
+		</tr>
+		<tr>		<td>cond 1</td>
+		<td>99.0</td>
+		<td>4.000</td>
+		<td>0.555</td>
+		<td><a href='#' onclick='return fullpopitup("images/dataset_9_files_cond-1_Read_Distributions.png")'><img src='images/dataset_9_files_cond-1_Read_Distributions.png' height='300'></a></td>
+		</tr>
+	</table>
+	<h2>Miscellaneous files</h2>
+	<p><a href='intermediate-results/dataset_9_files.intraCondPeakDistances.histo.txt'>Peak-peak distance histograms (same condition)</a></p>
+	</body>
+</html>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_replicates_counts1.tabular	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,25 @@
+Point	cond:1
+chr1:569927	14
+chr1:536042	1
+chr1:535151	1
+chr1:534819	1
+chr1:539540	1
+chr1:539980	1
+chr1:125172	1
+chr1:49533	1
+chr1:67349	1
+chr1:563501	1
+chr1:20107	1
+chr1:568610	2
+chr1:237754	2
+chr1:236192	2
+chr1:569214	2
+chr1:569652	2
+chr1:566215	2
+chr1:234414	2
+chr1:122967	2
+chr1:570152	5
+chr1:250516	2
+chr1:527636	3
+chr1:566984	3
+chr1:526421	2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg19_replicates_counts2.tabular	Wed Sep 05 08:54:21 2018 -0400
@@ -0,0 +1,25 @@
+Point	cond:1
+chr1:569927	14
+chr1:536042	1
+chr1:535151	1
+chr1:534819	1
+chr1:539540	1
+chr1:539980	1
+chr1:125172	1
+chr1:563501	1
+chr1:568610	2
+chr1:237754	2
+chr1:236192	2
+chr1:569214	2
+chr1:569652	2
+chr1:566215	2
+chr1:234414	2
+chr1:122967	2
+chr1:570152	5
+chr1:250516	2
+chr1:49533	1
+chr1:527636	3
+chr1:566984	3
+chr1:526421	2
+chr1:20107	1
+chr1:67349	1
--- a/test-data/output_html1.html	Mon Mar 06 09:17:58 2017 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,48 +0,0 @@
-<html>
-	<head><title>MultiGPS results (dataset_3100_files)</title></head>
-	<style type='text/css'>/* <![CDATA[ */ table, th{border-color: #600;border-style: solid;} td{border-color: #600;border-style: solid;} table{border-width: 0 0 1px 1px; border-spacing: 0;border-collapse: collapse;} th{margin: 0;padding: 4px;border-width: 1px 1px 0 0;} td{margin: 0;padding: 4px;border-width: 1px 1px 0 0;} /* ]]> */</style>
-	<script language='javascript' type='text/javascript'><!--
-function motifpopitup(url) {	newwindow=window.open(url,'name','height=75');	if (window.focus) {newwindow.focus()}	return false;}// --></script>
-	<script language='javascript' type='text/javascript'><!--
-function fullpopitup(url) {	newwindow=window.open(url,'name');	if (window.focus) {newwindow.focus()}	return false;}// --></script>
-	<body>
-	<h1>MultiGPS results (dataset_3100_files)</h1>
-	<p>MultiGPS version 0.5 run completed on: 2016/01/02 13:09:13 with arguments:
-  --verbose --threads 1 --geninfo /Users/gvk/work/git_workspace/galaxy/tool-data/shared/ucsc/chrom/sacCer3.len --seq ./database/tmp/tmp-multigps-seq-diryUz22y --probshared 0.900000 --r 3 --minmodelupdateevents 0 --nomodelsmoothing --gaussmodelsmoothing --gausssmoothparam 3 --design design.tabular --out /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/002/2194/dataset_3100_files
-</p>
-	<h2>Binding events</h2>
-	<table>
-		<tr>		<th>Condition</th>
-		<th>Events</th>
-		<th>File</th>
-		<th>Positional Prior Motif</th>
-		<th>Motif Relative Offset</th>
-		</tr>
-		<tr>		<td>Abf1</td>
-		<td>0</td>
-		<td><a href='dataset_3100_files_Abf1.events'>dataset_3100_files_Abf1.events</a></td>
-		<td>No motif found</td>
-		<td>NA</td>
-		</tr>
-	</table>
-	<h2>Input data</h2>
-	<table>
-		<tr>		<th>Replicate</th>
-		<th>ReadCount</th>
-		<th>CtrlScaling</th>
-		<th>SignalFraction</th>
-		<th>ReadDistributionModel</th>
-		</tr>
-		<tr>		<td>Abf1 1</td>
-		<td>0.0</td>
-		<td>NA</td>
-		<td>NaN</td>
-		<td><a href='#' onclick='return fullpopitup("images/dataset_3100_files_Abf1-1_Read_Distributions.png")'><img src='images/dataset_3100_files_Abf1-1_Read_Distributions.png' height='300'></a></td>
-		</tr>
-	</table>
-	<h2>Miscellaneous files</h2>
-	<p><a href='dataset_3100_files.motifs'>Positional prior motifs.</a> Try inputting these motifs into <a href='http://www.benoslab.pitt.edu/stamp/'>STAMP</a> for validation.</p>
-	<p><a href='intermediate-results/dataset_3100_files.intraCondPeakDistances.histo.txt'>Peak-peak distance histograms (same condition)</a></p>
-	<p><a href='intermediate-results/dataset_3100_files.peaks2motifs.histo.txt'>Peak-motif distance histograms</a></p>
-	</body>
-</html>
--- a/test-data/output_process1.txt	Mon Mar 06 09:17:58 2017 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,49 +0,0 @@
-Using default read distribution.
-Providing your own read distribution file is highly recommended. Use --d option.
-
-Processing HitLoaders for:	Abf1	1
-Loading from IDX hit loader:	/Users/gvk/work/git_workspace/galaxy/database/files/003/dataset_3093.dat
-Estimating scaling ratio for Abf1:1
-Loaded experiments:
- Condition Abf1:	#Replicates:	1
- Condition Abf1:	Rep Abf1:1
-	Signal:	0.0
-Finding potential binding regions.
-PotentialRegionFilter: genomic threshold for Abf1:1 with bin width 368 = 1
-0 potential regions found.
-Initialzing mixture model
-Caching sequences
-Caching completed
-Alpha Abf1	Range=368	1.0
-Global noise per base initialization for Abf1 = 0.0000
-Multi-condition positional priors:	A given B:-0.1520	A given notB:-Infinity
-
-============================ Round 0 ============================
-Updated Abf1:1 read distribution from 0 binding events.
-Alpha Abf1	Range=662	1.0
-MEME ExitValue: 1
-Abf1	NOMOTIF
-
-============================ Round 1 ============================
-Updated Abf1:1 read distribution from 0 binding events.
-Alpha Abf1	Range=762	1.0
-MEME ExitValue: 1
-Abf1	NOMOTIF
-
-============================ Round 2 ============================
-Refined Abf1:1 read distribution from 0 binding events.
-Alpha Abf1	Range=762	1.0
-MEME ExitValue: 1
-Abf1	NOMOTIF
-
-============================ ML read assignment ============================
-Abf1:1	0	signal-noise ratio:	NaN
-ML read assignment finished.
-
-============================= Post-processing ==============================
-Binding event detection finished!
-Binding events are printed to files in /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/002/2194/dataset_3100_files beginning with: /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/002/2194/dataset_3100_files
-Events post-analysis
-	Peak-motif distance histograms
-	Peak-peak distance histograms (same condition)
-Writing results report to: /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/002/2194/dataset_3100_files/multiGPS_dataset_3100_files_results.html
--- a/test-data/phiX.fasta	Mon Mar 06 09:17:58 2017 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,79 +0,0 @@
->phiX174
-GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
-GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
-ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
-TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
-GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
-TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
-TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
-CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
-TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
-TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
-GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
-CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
-TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
-AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
-CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
-TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
-TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
-CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
-GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
-GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
-ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
-TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
-TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
-ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
-CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
-GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
-CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
-TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
-TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
-TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
-AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
-TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
-ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
-GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
-TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
-TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
-TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
-TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
-CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
-AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
-CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
-TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
-CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
-AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
-GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
-GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
-TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
-CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
-TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
-GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
-CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
-TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
-AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
-TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
-CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
-TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
-TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
-CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
-TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
-ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
-TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
-ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
-GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
-CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
-GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
-GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
-ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
-CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
-CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
-GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
-CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
-CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
-TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
-TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
-TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
-AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
-TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
-
--- a/test-data/reb1_chipexo.distrib.tabular	Mon Mar 06 09:17:58 2017 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,151 +0,0 @@
--75	5.127879107699016E-4
--74	5.591849642345921E-4
--73	5.978066901355474E-4
--72	6.224861874065494E-4
--71	6.356594284636885E-4
--70	6.419131040936336E-4
--69	6.458339050830534E-4
--68	6.520085222186162E-4
--67	6.642177211211218E-4
--66	6.830185667478948E-4
--65	7.08162198890391E-4
--64	7.393997573400663E-4
--63	7.764823818883762E-4
--62	8.191343740323966E-4
--61	8.669726820916808E-4
--60	9.195874160914019E-4
--59	9.765686860567337E-4
--58	0.0010375066020128487
--57	0.0011017330590527004
--56	0.00116754709254036
--55	0.0012329895229076788
--54	0.0012961011705865087
--53	0.0013549228560087003
--52	0.0014098242005801068
--51	0.0014704900296025876
--50	0.0015489339693520027
--49	0.0016571696461042138
--48	0.0018072106861350802
--47	0.0020044404349732823
--46	0.002227721115158772
--45	0.0024492846684843195
--44	0.0026413630367426947
--43	0.0027761881617266704
--42	0.002836351287151588
--41	0.002845880864423082
--40	0.0028391646468693605
--39	0.00285059038781863
--38	0.0029145458405990974
--37	0.003054999456921908
--36	0.003254242482029955
--35	0.003484146859549071
--34	0.0037165845331050868
--33	0.003923427446323833
--32	0.004091558501282984
--31	0.0042679044338675715
--30	0.004514402938414466
--29	0.004892991709260541
--28	0.005465608440742671
--27	0.006242892200593844
--26	0.007030287550131535
--25	0.007581940424069329
--24	0.007651996757120818
--23	0.006994602483999588
--22	0.00556114033057625
--21	0.004091940187349483
--20	0.003524568735974988
--19	0.004796592658108461
--18	0.0088455786354056
--17	0.016163107580678765
--16	0.02545681733136696
--15	0.034988359956065855
--14	0.0430193875233711
--13	0.04781155210187838
--12	0.048136600329994075
--11	0.044806657125367494
--10	0.03914394197545865
--9	0.032470674367727596
--8	0.026109073789634344
--7	0.021118332556040682
--6	0.017505534291415395
--5	0.015014735447629032
--4	0.013389992476552141
--3	0.012375361830055257
--2	0.011749289178588132
--1	0.011427777066917324
-0	0.0113612172583886
-1	0.011500001516347726
-2	0.011794521604140462
-3	0.012179966617556161
-4	0.012530714982158502
-5	0.012705942455954753
-6	0.012564824796952177
-7	0.01196653776315804
-8	0.010832880494232516
-9	0.009336145656447381
-10	0.007711249297727332
-11	0.00619310746599705
-12	0.005016636209181219
-13	0.004352368176832731
-14	0.0041133024250172585
-15	0.004148054611428677
-16	0.004305240393760864
-17	0.004433475429707692
-18	0.004414343407977009
-19	0.004261300141332552
-20	0.004020769473552029
-21	0.003739175248413146
-22	0.0034629413096936134
-23	0.0032292248729375262
-24	0.003038116640754531
-25	0.002880440687520661
-26	0.002747021087611949
-27	0.0026286819154044297
-28	0.0025185949491149514
-29	0.002419322782323626
-30	0.00233577571245138
-31	0.002272864036919143
-32	0.0022354980531478397
-33	0.0022249651042246296
-34	0.002228060715901593
-35	0.0022279574595970427
-36	0.002207827906729291
-37	0.0021508446287166493
-38	0.0020466541811146616
-39	0.0019107990560277952
-40	0.0017652957296977485
-41	0.00163216067836622
-42	0.0015334103782749082
-43	0.0014847743229281654
-44	0.0014768340748809537
-45	0.0014938842139508909
-46	0.0015202193199555926
-47	0.0015401339727126753
-48	0.0015409295209052893
-49	0.0015219343886787202
-50	0.0014854837690437867
-51	0.0014339128550113077
-52	0.0013695568395921023
-53	0.0012956931215641026
-54	0.0012193679227736943
-55	0.0011485696708343764
-56	0.0010912867933596476
-57	0.0010555077179630066
-58	0.00104649552274266
-59	0.0010586118877356464
-60	0.0010834931434637114
-61	0.0011127756204486014
-62	0.0011380956492120624
-63	0.0011531119928568795
-64	0.0011595731448099929
-65	0.0011612500310793827
-66	0.0011619135776730276
-67	0.001165334710598908
-68	0.001173884139795982
-69	0.00118433171092713
-70	0.0011920470535862109
-71	0.0011923997973670843
-72	0.001180759571863609
-73	0.0011542417959203714
-74	0.0011169450453848613
-75	0.001074713685355297
--- a/test-data/sacCer3_1.scidx	Mon Mar 06 09:17:58 2017 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,102 +0,0 @@
-# source: 59707sacCer3.tab, format BED
-chrom	index	forward	reverse	value
-chr1	18	1	0	1
-chr1	34	0	1	1
-chr1	37	1	0	1
-chr1	39	0	2	2
-chr1	40	1	0	1
-chr1	42	1	0	1
-chr1	48	3	0	3
-chr1	52	1	0	1
-chr1	53	1	0	1
-chr1	91	1	0	1
-chr1	101	1	0	1
-chr1	156	1	0	1
-chr1	175	0	1	1
-chr1	226	1	0	1
-chr1	233	1	0	1
-chr1	236	0	1	1
-chr1	249	1	0	1
-chr1	268	1	0	1
-chr1	271	1	0	1
-chr1	287	1	0	1
-chr1	290	1	0	1
-chr1	292	0	1	1
-chr1	295	1	0	1
-chr1	322	1	0	1
-chr1	328	1	0	1
-chr1	330	1	0	1
-chr1	353	0	1	1
-chr1	364	1	0	1
-chr1	365	0	1	1
-chr1	375	1	0	1
-chr1	377	1	0	1
-chr1	382	0	1	1
-chr1	392	0	2	2
-chr1	411	1	0	1
-chr1	425	1	0	1
-chr1	427	1	0	1
-chr1	432	1	1	2
-chr1	434	1	0	1
-chr1	440	0	1	1
-chr1	441	0	1	1
-chr1	460	1	0	1
-chr1	466	1	0	1
-chr1	469	2	0	2
-chr1	480	1	0	1
-chr1	483	0	1	1
-chr1	490	1	0	1
-chr1	495	2	0	2
-chr1	496	0	1	1
-chr1	503	1	0	1
-chr1	512	1	0	1
-chr1	514	1	0	1
-chr1	517	1	0	1
-chr1	518	1	0	1
-chr1	520	1	0	1
-chr1	523	7	0	7
-chr1	524	1	0	1
-chr1	525	1	0	1
-chr1	526	3	0	3
-chr1	527	1	0	1
-chr1	528	2	2	4
-chr1	529	1	0	1
-chr1	531	0	1	1
-chr1	538	1	0	1
-chr1	543	2	1	3
-chr1	544	1	0	1
-chr1	545	0	1	1
-chr1	546	0	2	2
-chr1	547	1	0	1
-chr1	550	1	0	1
-chr1	551	1	1	2
-chr1	553	0	1	1
-chr1	557	1	1	2
-chr1	558	1	1	2
-chr1	560	0	2	2
-chr1	565	1	0	1
-chr1	567	2	2	4
-chr1	569	1	0	1
-chr1	570	0	1	1
-chr1	571	2	0	2
-chr1	572	1	0	1
-chr1	574	2	0	2
-chr1	575	0	1	1
-chr1	583	0	1	1
-chr1	587	3	0	3
-chr1	592	0	1	1
-chr1	594	0	1	1
-chr1	600	1	0	1
-chr1	602	0	1	1
-chr1	612	0	1	1
-chr1	621	1	1	2
-chr1	623	0	1	1
-chr1	628	1	0	1
-chr1	634	1	1	2
-chr1	635	0	2	2
-chr1	641	0	1	1
-chr1	643	1	0	1
-chr1	645	1	0	1
-chr1	647	1	0	1
-chr1	652	1	0	1
-chr1	654	0	1	1