Mercurial > repos > greg > grinder

comparison grinder-fa1fa683bcf1/grinder.xml @ 0:a41241d67693 default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author greg
date Wed, 18 Jan 2012 11:45:20 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:a41241d67693
1 <tool id="grinder" name="Grinder" version="0.4.3">
2
3 <description>versatile omic shotgun and amplicon read simulator</description>
4
5 <requirements>
6 <requirement type="binary">grinder</requirement>
7 </requirements>
8
9 <version_string>grinder --version</version_string>
10
11 <command interpreter="python">
12 stderr_wrapper.py
13 grinder
14 #if $reference_file.specify == "builtin":
15 -reference_file ${ filter( lambda x: str( x[0] ) == str( $reference_file.value ), $__app__.tool_data_tables[ 'all_fasta' ].get_fields() )[0][-1] }
16 #else if $reference_file.specify == "uploaded":
17 -reference_file $reference_file.value
18 #end if
19 #if str($coverage_fold):
20 -coverage_fold $coverage_fold
21 #end if
22 #if str($total_reads):
23 -total_reads $total_reads
24 #end if
25 #if str($read_dist):
26 -read_dist $read_dist
27 #end if
28 #if str($insert_dist):
29 -insert_dist $insert_dist
30 #end if
31 #if str($mate_orientation):
32 -mate_orientation $mate_orientation
33 #end if
34 #if str($exclude_chars):
35 -exclude_chars $exclude_chars
36 #end if
37 #if str($delete_chars):
38 -delete_chars $delete_chars
39 #end if
40 #if str($forward_reverse) != "None":
41 -forward_reverse $forward_reverse
42 #end if
43 #if str($unidirectional):
44 -unidirectional $unidirectional
45 #end if
46 #if str($length_bias):
47 -length_bias $length_bias
48 #end if
49 #if str($copy_bias):
50 -copy_bias $copy_bias
51 #end if
52 #if str($mutation_dist):
53 -mutation_dist $mutation_dist
54 #end if
55 #if str($mutation_ratio):
56 -mutation_ratio $mutation_ratio
57 #end if
58 #if str($homopolymer_dist):
59 -homopolymer_dist $homopolymer_dist
60 #end if
61 #if str($chimera_perc):
62 -chimera_perc $chimera_perc
63 #end if
64 #if str($chimera_dist):
65 -chimera_dist $chimera_dist
66 #end if
67 #if str($chimera_kmer):
68 -chimera_kmer $chimera_kmer
69 #end if
70 #if str($abundance_file) != "None":
71 -abundance_file $abundance_file
72 #end if
73 #if str($abundance_model):
74 -abundance_model $abundance_model
75 #end if
76 #if str($num_libraries):
77 -num_libraries $num_libraries
78 #end if
79 #if str($multiplex_ids) != "None":
80 -multiplex_ids $multiplex_ids
81 #end if
82 #if str($diversity):
83 -diversity $diversity
84 #end if
85 #if str($shared_perc):
86 -shared_perc $shared_perc
87 #end if
88 #if str($permuted_perc):
89 -permuted_perc $permuted_perc
90 #end if
91 #if str($random_seed):
92 -random_seed $random_seed
93 #end if
94 #if str($permuted_perc):
95 -desc_track $desc_track
96 #end if
97 #if str($qual_levels):
98 -qual_levels $qual_levels
99 #end if
100 #if str($fastq_output) == '1':
101 -fastq_output $fastq_output
102 #end if
103 #if str($profile_file) != "None":
104 -profile_file $profile_file.value
105 #end if
106 <!-- When Galaxy bug #661 is resolved, then we can use the same method to check for all optional argument -->
107 <!-- i.e. either if str($param) != "None": or if str($param): -->
108 <!-- URL: https://bitbucket.org/galaxy/galaxy-central/issue/661/optional-arguments-problems#comment-655611 -->
109 </command>
110
111 <inputs>
112
113 <conditional name="reference_file">
114 <param name="specify" type="select" label="Specify">
115 <option value="builtin">Built-in file</option>
116 <option value="uploaded">Uploaded file</option>
117 </param>
118 <when value="builtin">
119 <param name="value" type="select" label="Reference sequences (genomes, genes, transcripts, proteins)" help="Galaxy built-in FASTA file">
120 <options from_data_table="all_fasta" />
121 </param>
122 </when>
123 <when value="uploaded">
124 <param name="value" type="data" format="fasta" label="Reference sequences" help="FASTA file that contains the input reference sequences" />
125 </when>
126 </conditional>
127
128 <param name="total_reads" type="text" value="100" optional="true" label="Number of reads" help="Number of shotgun or amplicon reads to generate for each library. Do not specify this if you specify the fold coverage." />
129
130 <param name="coverage_fold" type="text" optional="true" label="Coverage fold" help="Desired fold coverage of the input reference sequences (the output FASTA length divided by the input FASTA length). Do not specify this if you specify the number of reads directly." />
131
132 <param name="read_dist" type="text" value="100" optional="true" label="Sequence length distribution" help="Desired sequence length distribution specified as:
133 average length, distribution ('uniform' or 'normal') and standard deviation
134 Only the first element is required.
135 Examples:
136 1/ All reads exactly 101 bp long (Illumina GA 2x): 101
137 2/ Uniform read distribution around 100+-10 bp: 100 uniform 10
138 3/ Reads normally distributed with an average of 800 and a standard deviation
139 of 100 bp (Sanger reads): 800 normal 100
140 4/ Reads normally distributed with an average of 450 and a standard deviation
141 of 50 bp (454 GS-FLX Ti): 450 normal 50
142 Reference sequences smaller than the specified read length are not used." />
143
144 <param name="insert_dist" type="text" value="0" optional="true" label="Insert size distribution" help="Create paired-end or mate-pair reads spanning the given insert length. Important: the insert is defined in the biological sense, i.e. its length includes the length of both reads and of the stretch of DNA between them:
145 0 : off,
146 or: insert size distribution in bp, in the same format as the read length
147 distribution (a typical value is 2,500 bp)
148 Two distinct reads are generated whether or not the mate pair overlaps." />
149
150 <param name="mate_orientation" type="text" value="FR" optional="true" label="Mate orientation" help="When generating paired-end or mate-pair reads (see the insert distribution parameter), specify the orientation of the reads (F: forward, R: reverse): FR for Sanger or Illumina paired-end, FF for 454, RF for Illumina mate-pairs, or RR" />
151
152 <param name="exclude_chars" type="text" optional="true" label="Characters to exclude" help="Do not create reads containing any of the specified characters (case insensitive), e.g. 'N-' to prevent reads with gaps (-) or ambiguities (N)." />
153
154 <param name="delete_chars" type="text" optional="true" label="Characters to delete" help="Remove the specified characters from the reference sequences (case insensitive), e.g. 'N-' to remove gaps (-) and ambiguities (N)." />
155
156 <param name="forward_reverse" type="data" format="fasta" optional="true" label="Amplicon primers" help="Use DNA amplicon sequencing using a forward and reverse PCR primer sequence provided in a FASTA file. The primer sequences should use the IUPAC convention for degenerate residues and the reference sequences that that do not match the specified primers are excluded. If your reference sequences are full genomes, it is recommended to turn the copy number bias option on and the length bias option off reads. To sequence from the forward strand, set the sequencing direction option to 1 and put the forward primer first and reverse primer second in the FASTA file. To sequence from the reverse strand, invert the primers in the FASTA file and use -1 for the sequencing direction option. The second primer sequence in the FASTA file is always optional. Example: AAACTYAAAKGAATTGRCGG and ACGGGCGGTGTGTRC for the 926F and 1392R primers that target the V6 to V9 region of the 16S rRNA gene." />
157
158 <param name="unidirectional" type="select" display="radio" value="0" label="Sequencing direction" help="Instead of producing reads bidirectionally, from the reference strand and its reverse complement, proceed unidirectionally, from one strand only (forward or reverse). Values: 0 (off, i.e. bidirectional), 1 (forward), -1 (reverse). Use the value 1 for strand specific transcriptomic or proteomic datasets.">
159 <option value="0">both strands</option>
160 <option value="1">forward strand only</option>
161 <option value="-1">reverse strand only</option>
162 </param>
163
164 <param name="length_bias" type="boolean" truevalue="1" falsevalue="0" checked="true" label="Length bias" help="In shotgun libraries, sample reference sequences proportionally to their length. For example, in simulated microbial datasets, this means that at the same relative abundance, larger genomes contribute more reads than smaller genomes. 0 = no, 1 = yes." />
165
166 <param name="copy_bias" type="boolean" truevalue="1" falsevalue="0" checked="true" label="Copy number bias" help="In amplicon libraries where full genomes are used as input, sample species proportionally to the number of copies of the target gene: at equal relative abundance, genomes that have multiple copies of the target gene contribute more amplicon reads than genomes that have a single copy. 0 = no, 1 = yes." />
167
168 <param name="mutation_dist" type="text" value="0" optional="true" label="Mutation distribution" help="Introduce sequencing errors in the reads, under the form of mutations (substitutions, insertions and deletions) at positions that follow a specified distribution (with replacement): model (uniform, linear, poly4), model parameters. For example, for a uniform 0.1% error rate, use: uniform 0.1. To simulate Sanger errors, use a linear model where the errror rate is 1% at the 5' end of reads and 2% at the 3' end: linear 1 2. To model Illumina errors using the 4th degree polynome 3e-3 + 3.3e-8 * i^4 (Korbel et al 2009), use: poly4 3e-3 3.3e-8. Use the mutation ratio option to alter how many of these mutations are substitutions
169 or indels." />
170
171 <param name="mutation_ratio" type="text" value="80 20" optional="true" label="Mutation ratio" help="Indicate the percentage of substitutions and the number of indels (insertions and deletions). For example, use '80 20' (4 substitutions for each indel) for Sanger reads. Note that this parameter has no effect unless you specify the mutation distribution option." />
172
173 <param name="homopolymer_dist" type="text" value="0" optional="true" label="Homopolymer distribution" help="Introduce sequencing errors in the reads under the form of homopolymeric stretches (e.g. AAA, CCCCC) using a specified model where the homopolymer length
174 follows a normal distribution N(mean, standard deviation) that is function of
175 the homopolymer length n.
176 Margulies: N(n, 0.15 * n), Margulies et al. 2005.
177 Richter: N(n, 0.15 * sqrt(n)), Richter et al. 2008.
178 Balzer: N(n, 0.03494 + n * 0.06856), Balzer et al. 2010." />
179
180 <param name="chimera_perc" type="text" value="0" optional="true" label="Percentage of chimeras" help="Specify the percent of reads in amplicon libraries that should be chimeric sequences. The 'reference' field in the description of chimeric reads will
181 contain the ID of all the reference sequences forming the chimeric template. A typical value is 10%." />
182
183 <param name="chimera_dist" type="text" value="314 38 1" optional="true" label="Multimera distribution" help="Specify the distribution of chimeras: bimeras, trimeras, quadrameras and multimeras of higher order. The default is the average values from Quince et al. 2011: '314 38 1', which corresponds to 89% of bimeras, 11% of trimeras and 0.3% of quadrameras. Note that this option only takes effect when you request the generation of chimeras with the chimera percentage option." />
184
185 <param name="chimera_kmer" type="text" value="10" optional="true" label="k-mer based chimeras" help="Activate a method to form chimeras by picking breakpoints at places where k-mers are shared between sequences. The value to provide to this option represents k, the length of the k-mers (in bp). The longer the kmer, the more similar the sequences have to be to be eligible to form chimeras. The more frequent a k-mer is in the pool of reference sequences (taking into account their relative abundance), the more often this k-mer will be chosen. For example, CHSIM (Edgar et al. 2011) uses a k-mer length of 10 bp. If you do not want to use k-mer information to form chimeras, use 0, which will result in the reference sequences and breakpoints to be taken randomly. Note that this option only takes effect when you request the generation of chimeras with the chimera percentage option." />
186
187 <param name="abundance_file" type="data" format="tabular" optional="true" label="Abundance file" help="Specify the relative abundance of the reference sequencse manually in an input file. Each line of the file should contain a sequence name and its relative abundance (%), e.g. 'seqABC 82.1' or 'seqABC 82.1 10.2' if you are specifying two different libraries." />
188
189 <param name="abundance_model" type="text" value="uniform 1" optional="true" label="Rank abundance model" help="Relative abundance model for the input reference sequences: uniform, linear, powerlaw, logarithmic or exponential. The uniform and linear models do not require a parameter, but the other models take a parameter in the range [0, infinity). If this parameter is not specified, then it is randomly chosen. Examples:
190
191 uniform distribution: uniform
192 powerlaw distribution with parameter 0.1: powerlaw 0.1
193 exponential distribution with automatically chosen parameter: exponential" />
194
195 <param name="num_libraries" type="text" value="1" optional="true" label="Number of libraries" help="Number of independent libraries to create. Specify how diverse and similar they should be using the diversity, shared percent and permuted percent options. Assign them different MID tags with the multiplex mids option. Note that in Galaxy, the maximum number of libraries is 10." />
196
197 <param name="multiplex_ids" type="data" format="fasta" optional="true" label="Specify MID tags file" help="Specify an optional FASTA file that contains sequence identifiers (a.k.a MIDs or barcodes) to add to the sequences (one sequence per library)."/>
198
199 <!-- When Galaxy bug #661 is resolved, then we can really have optional parameters of type "integer" or "float" -->
200 <!-- URL: https://bitbucket.org/galaxy/galaxy-central/issue/661/optional-arguments-problems#comment-655611 -->
201 <!-- Affected params: diversity (int), shared_perc (float), permuted_perc (float), random_seed (int), num_libraries (int), chimera_perc (float) -->
202 <param name="diversity" type="text" optional="true" label="Diversity (richness)" help="Richness, or number of reference sequences to include in the shotgun libraries. Use 0 for the maximum diversity possible (based on the number of reference sequences
203 available). Provide one value to make all libraries have the same diversity, or one diversity value per library otherwise." />
204
205 <param name="shared_perc" type="text" value="0" optional="true" label="Percent shared" help="For multiple libraries, percent of reference sequences they should have in common (relative to the diversity of the least diverse library)." />
206
207 <param name="permuted_perc" type="text" value="0" optional="true" label="Percent permuted" help="For multiple libraries, percent of the most-abundant reference sequences to permute in rank-abundance." />
208
209 <param name="random_seed" type="text" optional="true" label="Random seed" help="Seed number to use for the pseudo-random number generator." />
210
211 <param name="desc_track" type="boolean" truevalue="1" falsevalue="0" checked="true" label="Read tracking" help="Track read information (reference sequence, position, errors, ...) by writing it in the FASTA read description." />
212
213 <param name="qual_levels" type="text" optional="true" label="Quality score levels" help="Generate basic quality scores for the simulated reads. Good residues are given a specified good score (e.g. 30) and residues that are the result of an insertion or substitution are given a specified bad score (e.g. 10). Specify first the good score and then the bad score, e.g. '30 10'" />
214
215 <param name="fastq_output" type="boolean" truevalue="1" falsevalue="0" checked="false" label="FASTQ output" help="
216 Write the generated reads in FASTQ format (Sanger variant) instead of FASTA and
217 QUAL. Quality score levels need to be specified for this option to be effective." />
218
219 <param name="profile_file" type="data" format="txt" optional="true" label="Profile file" help="A file that contains Grinder arguments. This is useful if you use many options or often use the same options. Lines with comments (#) are ignored. Consider the profile file, 'simple_profile.txt':
220
221 # A simple Grinder profile
222 -read_dist 105 normal 12
223 -total_reads 1000
224
225 Running: grinder -reference_file viral_genomes.fa -profile_file simple_profile.txt
226
227 Translates into: grinder -reference_file viral_genomes.fa -read_dist 105 normal 12 -total_reads 1000
228
229 Note that the arguments specified in the profile should not be specified again on the command line." />
230
231 </inputs>
232
233
234 <outputs>
235
236 <!-- single library output -->
237 <data format="tabular" name="ranks" from_work_dir="grinder-ranks.txt" label="${tool.name} ranks from ${on_string}">
238 <filter>int(str(num_libraries)) == 1</filter>
239 </data>
240 <data format="fasta" name="fasta" from_work_dir="grinder-reads.fa" label="${tool.name} reads from ${on_string}">
241 <filter>int(str(num_libraries)) == 1 and fastq_output == 0</filter>
242 </data>
243 <data format="qual" name="qual" from_work_dir="grinder-reads.qual" label="${tool.name} quals from ${on_string}">
244 <filter>int(str(num_libraries)) == 1 and str(qual_levels) and fastq_output == 0</filter>
245 </data>
246 <data format="fastqsanger" name="fastq" from_work_dir="grinder-reads.fastq" label="${tool.name} reads from ${on_string}">
247 <filter>int(str(num_libraries)) == 1 and fastq_output == 1</filter>
248 </data>
249
250 <!-- When Galaxy bug #670 is resolved, then we won't have to harcode the number of output datasets -->
251 <!-- URL: https://bitbucket.org/galaxy/galaxy-central/issue/670/better-support-for-multiple-outputs -->
252
253 <!-- multiple libraries: library 1 -->
254 <data format="tabular" name="ranks1" from_work_dir="grinder-1-ranks.txt" label="${tool.name} lib 1 ranks from ${on_string}">
255 <filter>int(str(num_libraries)) >= 2</filter>
256 </data>
257 <data format="fasta" name="fasta1" from_work_dir="grinder-1-reads.fa" label="${tool.name} lib 1 reads from ${on_string}">
258 <filter>int(str(num_libraries)) >= 2 and fastq_output == 0</filter>
259 </data>
260 <data format="qual" name="qual1" from_work_dir="grinder-1-reads.qual" label="${tool.name} lib 1 quals from ${on_string}">
261 <filter>int(str(num_libraries)) >= 2 and str(qual_levels) and fastq_output == 0</filter>
262 </data>
263 <data format="fastqsanger" name="fastq1" from_work_dir="grinder-1-reads.fastq" label="${tool.name} lib 1 reads from ${on_string}">
264 <filter>int(str(num_libraries)) >= 2 and fastq_output == 1</filter>
265 </data>
266
267 <!-- multiple libraries: library 2 -->
268 <data format="tabular" name="ranks2" from_work_dir="grinder-2-ranks.txt" label="${tool.name} lib 2 ranks from ${on_string}">
269 <filter>int(str(num_libraries)) >= 2</filter>
270 </data>
271 <data format="fasta" name="fasta2" from_work_dir="grinder-2-reads.fa" label="${tool.name} lib 2 reads from ${on_string}">
272 <filter>int(str(num_libraries)) >= 2 and fastq_output == 0</filter>
273 </data>
274 <data format="qual" name="qual2" from_work_dir="grinder-2-reads.qual" label="${tool.name} lib 2 quals from ${on_string}">
275 <filter>int(str(num_libraries)) >= 2 and str(qual_levels) and fastq_output == 0</filter>
276 </data>
277 <data format="fastqsanger" name="fastq2" from_work_dir="grinder-2-reads.fastq" label="${tool.name} lib 2 reads from ${on_string}">
278 <filter>int(str(num_libraries)) >= 2 and fastq_output == 1</filter>
279 </data>
280
281 <!-- multiple libraries: library 3 -->
282 <data format="tabular" name="ranks3" from_work_dir="grinder-3-ranks.txt" label="${tool.name} lib 3 ranks from ${on_string}">
283 <filter>int(str(num_libraries)) >= 3</filter>
284 </data>
285 <data format="fasta" name="fasta3" from_work_dir="grinder-3-reads.fa" label="${tool.name} lib 3 reads from ${on_string}">
286 <filter>int(str(num_libraries)) >= 3 and fastq_output == 0</filter>
287 </data>
288 <data format="qual" name="qual3" from_work_dir="grinder-3-reads.qual" label="${tool.name} lib 3 quals from ${on_string}">
289 <filter>int(str(num_libraries)) >= 3 and str(qual_levels) and fastq_output == 0</filter>
290 </data>
291 <data format="fastqsanger" name="fastq3" from_work_dir="grinder-3-reads.fastq" label="${tool.name} lib 3 reads from ${on_string}">
292 <filter>int(str(num_libraries)) >= 3 and fastq_output == 1</filter>
293 </data>
294
295 <!-- multiple libraries: library 4 -->
296 <data format="tabular" name="ranks4" from_work_dir="grinder-4-ranks.txt" label="${tool.name} lib 4 ranks from ${on_string}">
297 <filter>int(str(num_libraries)) >= 4</filter>
298 </data>
299 <data format="fasta" name="fasta4" from_work_dir="grinder-4-reads.fa" label="${tool.name} lib 4 reads from ${on_string}">
300 <filter>int(str(num_libraries)) >= 4 and fastq_output == 0</filter>
301 </data>
302 <data format="qual" name="qual4" from_work_dir="grinder-4-reads.qual" label="${tool.name} lib 4 quals from ${on_string}">
303 <filter>int(str(num_libraries)) >= 4 and str(qual_levels) and fastq_output == 0</filter>
304 </data>
305 <data format="fastqsanger" name="fastq4" from_work_dir="grinder-4-reads.fastq" label="${tool.name} lib 4 reads from ${on_string}">
306 <filter>int(str(num_libraries)) >= 4 and fastq_output == 1</filter>
307 </data>
308
309 <!-- multiple libraries: library 5 -->
310 <data format="tabular" name="ranks5" from_work_dir="grinder-5-ranks.txt" label="${tool.name} lib 5 ranks from ${on_string}">
311 <filter>int(str(num_libraries)) >= 5</filter>
312 </data>
313 <data format="fasta" name="fasta5" from_work_dir="grinder-5-reads.fa" label="${tool.name} lib 5 reads from ${on_string}">
314 <filter>int(str(num_libraries)) >= 5 and fastq_output == 0</filter>
315 </data>
316 <data format="qual" name="qual5" from_work_dir="grinder-5-reads.qual" label="${tool.name} lib 5 quals from ${on_string}">
317 <filter>int(str(num_libraries)) >= 5 and str(qual_levels) and fastq_output == 0</filter>
318 </data>
319 <data format="fastqsanger" name="fastq5" from_work_dir="grinder-5-reads.fastq" label="${tool.name} lib 5 reads from ${on_string}">
320 <filter>int(str(num_libraries)) >= 5 and fastq_output == 1</filter>
321 </data>
322
323 <!-- multiple libraries: library 6 -->
324 <data format="tabular" name="ranks6" from_work_dir="grinder-6-ranks.txt" label="${tool.name} lib 6 ranks from ${on_string}">
325 <filter>int(str(num_libraries)) >= 6</filter>
326 </data>
327 <data format="fasta" name="fasta6" from_work_dir="grinder-6-reads.fa" label="${tool.name} lib 6 reads from ${on_string}">
328 <filter>int(str(num_libraries)) >= 6 and fastq_output == 0</filter>
329 </data>
330 <data format="qual" name="qual6" from_work_dir="grinder-6-reads.qual" label="${tool.name} lib 6 quals from ${on_string}">
331 <filter>int(str(num_libraries)) >= 6 and str(qual_levels) and fastq_output == 0</filter>
332 </data>
333 <data format="fastqsanger" name="fastq6" from_work_dir="grinder-6-reads.fastq" label="${tool.name} lib 6 reads from ${on_string}">
334 <filter>int(str(num_libraries)) >= 6 and fastq_output == 1</filter>
335 </data>
336
337 <!-- multiple libraries: library 7 -->
338 <data format="tabular" name="ranks7" from_work_dir="grinder-7-ranks.txt" label="${tool.name} lib 7 ranks from ${on_string}">
339 <filter>int(str(num_libraries)) >= 7</filter>
340 </data>
341 <data format="fasta" name="fasta7" from_work_dir="grinder-7-reads.fa" label="${tool.name} lib 7 reads from ${on_string}">
342 <filter>int(str(num_libraries)) >= 7 and fastq_output == 0</filter>
343 </data>
344 <data format="qual" name="qual7" from_work_dir="grinder-7-reads.qual" label="${tool.name} lib 7 quals from ${on_string}">
345 <filter>int(str(num_libraries)) >= 7 and str(qual_levels) and fastq_output == 0</filter>
346 </data>
347 <data format="fastqsanger" name="fastq7" from_work_dir="grinder-7-reads.fastq" label="${tool.name} lib 7 reads from ${on_string}">
348 <filter>int(str(num_libraries)) >= 7 and fastq_output == 1</filter>
349 </data>
350
351 <!-- multiple libraries: library 8 -->
352 <data format="tabular" name="ranks8" from_work_dir="grinder-8-ranks.txt" label="${tool.name} lib 8 ranks from ${on_string}">
353 <filter>int(str(num_libraries)) >= 8</filter>
354 </data>
355 <data format="fasta" name="fasta8" from_work_dir="grinder-8-reads.fa" label="${tool.name} lib 8 reads from ${on_string}">
356 <filter>int(str(num_libraries)) >= 8 and fastq_output == 0</filter>
357 </data>
358 <data format="qual" name="qual8" from_work_dir="grinder-8-reads.qual" label="${tool.name} lib 8 quals from ${on_string}">
359 <filter>int(str(num_libraries)) >= 8 and str(qual_levels) and fastq_output == 0</filter>
360 </data>
361 <data format="fastqsanger" name="fastq8" from_work_dir="grinder-8-reads.fastq" label="${tool.name} lib 8 reads from ${on_string}">
362 <filter>int(str(num_libraries)) >= 8 and fastq_output == 1</filter>
363 </data>
364
365 <!-- multiple libraries: library 9 -->
366 <data format="tabular" name="ranks9" from_work_dir="grinder-9-ranks.txt" label="${tool.name} lib 9 ranks from ${on_string}">
367 <filter>int(str(num_libraries)) >= 9</filter>
368 </data>
369 <data format="fasta" name="fasta9" from_work_dir="grinder-9-reads.fa" label="${tool.name} lib 9 reads from ${on_string}">
370 <filter>int(str(num_libraries)) >= 9 and fastq_output == 0</filter>
371 </data>
372 <data format="qual" name="qual9" from_work_dir="grinder-9-reads.qual" label="${tool.name} lib 9 quals from ${on_string}">
373 <filter>int(str(num_libraries)) >= 9 and str(qual_levels) and fastq_output == 0</filter>
374 </data>
375 <data format="fastqsanger" name="fastq9" from_work_dir="grinder-9-reads.fastq" label="${tool.name} lib 9 reads from ${on_string}">
376 <filter>int(str(num_libraries)) >= 9 and fastq_output == 1</filter>
377 </data>
378
379 <!-- multiple libraries: library 10 -->
380 <data format="tabular" name="ranks10" from_work_dir="grinder-10-ranks.txt" label="${tool.name} lib 10 ranks from ${on_string}">
381 <filter>int(str(num_libraries)) >= 10</filter>
382 </data>
383 <data format="fasta" name="fasta10" from_work_dir="grinder-10-reads.fa" label="${tool.name} lib 10 reads from ${on_string}">
384 <filter>int(str(num_libraries)) >= 10 and fastq_output == 0</filter>
385 </data>
386 <data format="qual" name="qual10" from_work_dir="grinder-10-reads.qual" label="${tool.name} lib 10 quals from ${on_string}">
387 <filter>int(str(num_libraries)) >= 10 and str(qual_levels) and fastq_output == 0</filter>
388 </data>
389 <data format="fastqsanger" name="fastq10" from_work_dir="grinder-10-reads.fastq" label="${tool.name} lib 10 reads from ${on_string}">
390 <filter>int(str(num_libraries)) >= 10 and fastq_output == 1</filter>
391 </data>
392
393 </outputs>
394
395 <tests>
396 <!-- no tests since they would not not always return the same results -->
397 <!--
398 <test>
399 <param name="specify" value="uploaded" />
400 <param name="value" value="ngs_simulation_in1.fasta" ftype="fasta" />
401 <output name="ranks" file="" />
402 <output name="fasta" file="" />
403 <output name="qual" file="" />
404 </test>
405
406 <test>
407 <param name="specify" value="builtin" />
408 <param name="builtin" value="pUC18" />
409 <output name="ranks" file="" />
410 <output name="fasta" file="" />
411 <output name="qual" file="" />
412 </test>
413 -->
414 </tests>
415
416 <help>
417
418 **What it does**
419
420 Grinder is a program to create random shotgun and amplicon sequence libraries
421 based on reference sequences in a FASTA file. Features include:
422
423 * omic support: genomic, metagenomic, transcriptomic, metatranscriptomic,
424 proteomic and metaproteomic
425 * shotgun library or amplicon library
426 * arbitrary read length distribution and number of reads
427 * simulation of PCR and sequencing errors (chimeras, point mutations, homopolymers)
428 * support for creating paired-end (mate pair) datasets
429 * specific rank-abundance settings or manually given abundance for each genome
430 * creation of datasets with a given richness (alpha diversity)
431 * independent datasets can share a variable number of genomes (beta diversity)
432 * modeling of the bias created by varying genome lengths or gene copy number
433 * profile mechanism to store preferred options
434 * API to automate the creation of a large number of simulated datasets
435
436
437 **Input**
438
439 A variety of FASTA databases containing genes or genomes can be used as input
440 for Grinder, such as the NCBI RefSeq collection (ftp://ftp.ncbi.nih.gov/refseq/release/microbial/),
441 the GreenGenes 16S rRNA database (http://greengenes.lbl.gov/Download/Sequence_Data/Fasta_data_files/Isolated_named_strains_16S_aligned.fasta), the human genome and transcriptome (ftp://ftp.ncbi.nih.gov/refseq/H_sapiens/RefSeqGene/, ftp://ftp.ncbi.nih.gov/refseq/H_sapiens/mRNA_Prot/human.rna.fna.gz), ...
442
443 These input files can either be provided as a Galaxy dataset, or can be uploaded
444 by Galaxy users in their history.
445
446
447 **Output**
448
449 For each library requested, a first file contains the abundance of the species
450 in the simulated community created, e.g.::
451
452 # rank seqID rel. abundance
453 1 86715_Lachnospiraceae 0.367936925098555
454 2 6439_Neisseria_polysaccharea 0.183968462549277
455 3 103712_Fusobacterium_nucleatum 0.122645641699518
456 4 103024_Frigoribacterium 0.0919842312746386
457 5 129066_Streptococcus_pyogenes 0.0735873850197109
458 6 106485_Pseudomonas_aeruginosa 0.0613228208497591
459 7 13824_Veillonella_criceti 0.0525624178712221
460 8 28044_Lactosphaera 0.0459921156373193
461
462 The second file is a FASTA file containing shotgun or amplicon reads, e.g.::
463
464 >1 reference=13824_Veillonella_criceti position=89-1088 strand=+
465 ACCAACCTGCCCTTCAGAGGGGGATAACAACGGGAAACCGTTGCTAATACCGCGTACGAA
466 TGGACTTCGGCATCGGAGTTCATTGAAAGGTGGCCTCTATTTATAAGCTATCGCTGAAGG
467 AGGGGGTTGCGTCTGATTAGCTAGTTGGAGGGGTAATGGCCCACCAAGGCAA
468
469 >2 reference=103712_Fusobacterium_nucleatum position=2-1001 strand=+
470 TGAACGAAGAGTTTGATCCTGGCTCAGGATGAACGCTGACAGAATGCTTAACACATGCAA
471 GTCAACTTGAATTTGGGTTTTTAACTTAGGTTTGGG
472
473 If you specify the quality score levels option, a third file representing the
474 quality scores of the reads is created::
475
476 >1 reference=103712_Fusobacterium_nucleatum position=2-1001 strand=+
477 30 30 30 10 30 30 ...
478
479
480 </help>
481
482 </tool>
483