--- a/extract_genomic_dna.xml	Wed Jan 20 07:37:31 2016 -0500
+++ b/extract_genomic_dna.xml	Wed Mar 02 09:13:24 2016 -0500
@@ -1,4 +1,4 @@
-<tool id="Extract genomic DNA 1" name="Extract Genomic DNA" version="3.0.0">
+<tool id="Extract genomic DNA 1" name="Extract Genomic DNA" version="3.0.2">
     <description>using coordinates from assembled/unassembled genomes</description>
     <requirements>
         <requirement type="package" version="0.7.1">bx-python</requirement>
@@ -26,7 +26,10 @@
             #else:
                 --reference_genome $reference_genome_cond.reference_genome
             #end if
-            --output_format $output_format
+            --output_format $output_format_cond.output_format
+            #if str($output_format_cond.output_format) == "fasta":
+                --description_field_delimiter $output_format_cond.description_field_delimiter
+            #end if
             --output $output
         ]]>
     </command>
@@ -60,15 +63,27 @@
                 </param>
             </when>
         </conditional>
-        <param name="output_format" type="select" label="Select output format">
-            <option value="fasta" selected="True">fasta</option>
-            <option value="interval">interval</option>
-        </param>
+        <conditional name="output_format_cond">
+            <param name="output_format" type="select" label="Select output format">
+                <option value="fasta" selected="True">fasta</option>
+                <option value="interval">interval</option>
+            </param>
+            <when value="fasta">
+                <param name="description_field_delimiter" type="select" label="Select description field delimiter" help="Character delimiter for words in description line">
+                    <option value="underscore" selected="True">underscore (_)</option>
+                    <option value="semicolon">semicolon (;)</option>
+                    <option value="comma">comma (,)</option>
+                    <option value="tilda">tilda (~)</option>
+                    <option value="vetical_bar">vertical bar (|)</option>
+                </param>
+            </when>
+            <when value="interval"/>
+        </conditional>
     </inputs>
     <outputs>
         <data format_source="input" name="output" metadata_source="input">
             <change_format>
-                <when input="output_format" value="fasta" format="fasta" />
+                <when input="output_format_cond.output_format" value="fasta" format="fasta" />
             </change_format>
         </data>
     </outputs>
@@ -78,6 +93,7 @@
             <param name="interpret_features" value="yes"/>
             <param name="index_source" value="cached"/>
             <param name="out_format" value="fasta"/>
+            <param name="description_field_delimiter" value="underscore"/>
             <output name="out_file1" file="extract_genomic_dna_out1.fasta" compare="contains" />
         </test>
         <test>
@@ -85,6 +101,7 @@
             <param name="interpret_features" value="yes"/>
             <param name="index_source" value="cached"/>
             <param name="out_format" value="fasta"/>
+            <param name="description_field_delimiter" value="underscore"/>
             <output name="out_file1" file="extract_genomic_dna_out2.fasta" compare="contains" />
         </test>
         <test>
@@ -105,8 +122,9 @@
         <test>
             <param name="input" value="gff_filter_by_attribute_out1.gff" dbkey="mm9" ftype="gff" />
             <param name="interpret_features" value="no"/>
+            <param name="index_source" value="cached"/>
             <param name="out_format" value="fasta"/>
-            <param name="index_source" value="cached"/>
+            <param name="description_field_delimiter" value="underscore"/>
             <output name="out_file1" file="extract_genomic_dna_out5.fasta" compare="contains" />
         </test>
         <!-- Test custom sequences support and GFF feature interpretation. -->
@@ -116,6 +134,7 @@
             <param name="index_source" value="history"/>
             <param name="ref_file" value="tophat_in1.fasta"/>
             <param name="out_format" value="fasta"/>
+            <param name="description_field_delimiter" value="underscore"/>
             <output name="out_file1" file="extract_genomic_dna_out6.fasta" compare="contains" />
         </test>
         <test>
@@ -124,6 +143,7 @@
             <param name="index_source" value="history"/>
             <param name="ref_file" value="tophat_in1.fasta"/>
             <param name="out_format" value="fasta"/>
+            <param name="description_field_delimiter" value="underscore"/>
             <output name="out_file1" file="extract_genomic_dna_out7.fasta" compare="contains" />
         </test>
     </tests>
@@ -145,15 +165,19 @@
  - Chromosome, start or end coordinates that are invalid for the specified build.
  - Any lines whose data columns are not separated by a **TAB** character ( other white-space characters are invalid ).
 
-.. class:: infomark
-
- **Extract genomic DNA using coordinates from ASSEMBLED genomes and UNassembled genomes** previously were achieved by two separate tools. 
-
 -----
 
 **What it does**
 
 This tool uses coordinate, strand, and build information to fetch genomic DNAs in FASTA or interval format.
+If the output format is FASTA, the character delimiter can be selected for the fields in the description.
+For example, selecting an underscore will produce a description like this:
+
+    >gi_31563518_ref_NP_852610.1
+
+while selecting a vertical bar will produce a description like this:
+
+    >gi|31563518|ref|NP_852610.1
 
 If strand is not defined, the default value is "+".
 
@@ -167,7 +191,7 @@
     chr7  127485994  127486166  NM_000230  0  +
     chr7  127486011  127486166  D49487     0  +
 
-Extracting sequences with **FASTA** output data type returns::
+Extracting sequences with **FASTA** output data type  and **Description Field Delimiter** set to the underscore character returns::
 
     &gt;hg17_chr7_127475281_127475310_+ NM_000230
     GTAGGAATCGCAGCGCCAGCGGTTGCAAG
@@ -192,7 +216,7 @@
     <citations>
         <citation type="bibtex">
             @unpublished{None,
-            author = {Guru Ananda,Greg Von Kuster},
+            author = {Guru Ananda},
             title = {None},
             year = {None},
             eprint = {None},