Mercurial > repos > galaxyp > pepquery2

comparison pepquery2.xml @ 1:6b5ce9e2b0d0 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproteomics/tools-galaxyp/tree/master/tools/pepquery2 commit 3f50a508dbb9050be48de5685cec9a82683d8457
author galaxyp
date Sun, 02 Oct 2022 23:50:18 +0000
parents 3c45645197f6
children 3b2874c58bcd
comparison
equal deleted inserted replaced
0:3c45645197f6 1:6b5ce9e2b0d0
133 -plot 133 -plot
134 #end if 134 #end if
135 $fast 135 $fast
136 -o pepquery_output 136 -o pepquery_output
137 | sed 's/No valid peptide/Error: No valid peptide/' | tee >(cat 1>&2) 137 | sed 's/No valid peptide/Error: No valid peptide/' | tee >(cat 1>&2)
138 #set $flist = str($outputs_selected).replace(',',' ')
139 && for i in $flist; do for f in `find pepquery_output/*/* -name \$i`; do cat \$f >> pepquery_output/\${i}; done; done
140 && for f in `find pepquery_output/*/ -name parameter.txt`; do cp \$f pepquery_output/parameter.txt; done
138 ]]> 141 ]]>
139 </command> 142 </command>
140 <inputs> 143 <inputs>
141 <conditional name="validation"> 144 <conditional name="validation">
142 <param name="task_type" argument="-s" type="select" label="Validation Task Type"> 145 <param name="task_type" argument="-s" type="select" label="Validation Task Type">
251 <when value="indexed"> 254 <when value="indexed">
252 <param name="index" argument="-ms" type="data" format="txt" label="PepQuery Index" help="" /> 255 <param name="index" argument="-ms" type="data" format="txt" label="PepQuery Index" help="" />
253 </when> 256 </when>
254 <when value="PepQueryDB"> 257 <when value="PepQueryDB">
255 <param name="dataset" argument="-b" type="text" value="" label="PepQueryDB dataset"> 258 <param name="dataset" argument="-b" type="text" value="" label="PepQueryDB dataset">
256 <option value="all">all</option> 259 <help>PepQueryDB dataset IDs (separated by commas).</help>
257 <option value="w">w:global proteome</option> 260 <expand macro="pepquerydb_options" />
258 <option value="p">p:phosphorylation</option> 261 <validator type="regex" message="PepQueryDB dataset_name(,dataset_name)">^[a-zA-Z][^,]*(,[a-zA-Z][^,]*)*$</validator>
259 <option value="a">a:acetylation</option>
260 <option value="u">u:ubiquitination</option>
261 <option value="g">g:glycosylation</option>
262 <option value="Academia_Sinica_LUAD100_Phosphoproteome_PDC000220">Academia_Sinica_LUAD100_Phosphoproteome_PDC000220</option>
263 <option value="Academia_Sinica_LUAD100_Proteome_PDC000219">Academia_Sinica_LUAD100_Proteome_PDC000219</option>
264 <option value="CCLE_proteome_MSV000085836">CCLE_proteome_MSV000085836</option>
265 <option value="CPTAC">CPTAC</option>
266 <option value="CPTAC_CCRCC_Discovery_Study_Phosphoproteme_PDC000128">CPTAC_CCRCC_Discovery_Study_Phosphoproteme_PDC000128</option>
267 <option value="CPTAC_CCRCC_Discovery_Study_Proteome_PDC000127">CPTAC_CCRCC_Discovery_Study_Proteome_PDC000127</option>
268 <option value="CPTAC_GBM_Discovery_Study_Acetylome_PDC000245">CPTAC_GBM_Discovery_Study_Acetylome_PDC000245</option>
269 <option value="CPTAC_GBM_Discovery_Study_Phosphoproteome_PDC000205">CPTAC_GBM_Discovery_Study_Phosphoproteome_PDC000205</option>
270 <option value="CPTAC_GBM_Discovery_Study_Proteome_PDC000204">CPTAC_GBM_Discovery_Study_Proteome_PDC000204</option>
271 <option value="CPTAC_HNSCC_Discovery_Study_Phosphoproteome_PDC000222">CPTAC_HNSCC_Discovery_Study_Phosphoproteome_PDC000222</option>
272 <option value="CPTAC_HNSCC_Discovery_Study_Proteome_PDC000221">CPTAC_HNSCC_Discovery_Study_Proteome_PDC000221</option>
273 <option value="CPTAC_LSCC_Discovery_Study_Acetylome_PDC000233">CPTAC_LSCC_Discovery_Study_Acetylome_PDC000233</option>
274 <option value="CPTAC_LSCC_Discovery_Study_Phosphoproteome_PDC000232">CPTAC_LSCC_Discovery_Study_Phosphoproteome_PDC000232</option>
275 <option value="CPTAC_LSCC_Discovery_Study_Proteome_PDC000234">CPTAC_LSCC_Discovery_Study_Proteome_PDC000234</option>
276 <option value="CPTAC_LSCC_Discovery_Study_Ubiquitylome_PDC000237">CPTAC_LSCC_Discovery_Study_Ubiquitylome_PDC000237</option>
277 <option value="CPTAC_LUAD_Discovery_Study_Acetylome_PDC000224">CPTAC_LUAD_Discovery_Study_Acetylome_PDC000224</option>
278 <option value="CPTAC_LUAD_Discovery_Study_Phosphoproteome_PDC000149">CPTAC_LUAD_Discovery_Study_Phosphoproteome_PDC000149</option>
279 <option value="CPTAC_LUAD_Discovery_Study_Proteome_PDC000153">CPTAC_LUAD_Discovery_Study_Proteome_PDC000153</option>
280 <option value="CPTAC_PDA_Discovery_Study_Phosphoproteome_PDC000271">CPTAC_PDA_Discovery_Study_Phosphoproteome_PDC000271</option>
281 <option value="CPTAC_PDA_Discovery_Study_Proteome_PDC000270">CPTAC_PDA_Discovery_Study_Proteome_PDC000270</option>
282 <option value="CPTAC_Pediatric_Brain_Cancer_Pilot_Study_Phosphoproteome_PDC000176">CPTAC_Pediatric_Brain_Cancer_Pilot_Study_Phosphoproteome_PDC000176</option>
283 <option value="CPTAC_Pediatric_Brain_Cancer_Pilot_Study_Proteome_PDC000180">CPTAC_Pediatric_Brain_Cancer_Pilot_Study_Proteome_PDC000180</option>
284 <option value="CPTAC_Prospective_Breast_BI_Acetylome_PDC000239">CPTAC_Prospective_Breast_BI_Acetylome_PDC000239</option>
285 <option value="CPTAC_Prospective_Breast_BI_Phosphoproteome_PDC000121">CPTAC_Prospective_Breast_BI_Phosphoproteome_PDC000121</option>
286 <option value="CPTAC_Prospective_Breast_BI_Proteome_PDC000120">CPTAC_Prospective_Breast_BI_Proteome_PDC000120</option>
287 <option value="CPTAC_Prospective_Colon_PNNL_Phosphoproteome_PDC000117">CPTAC_Prospective_Colon_PNNL_Phosphoproteome_PDC000117</option>
288 <option value="CPTAC_Prospective_Colon_PNNL_Proteome_PDC000116">CPTAC_Prospective_Colon_PNNL_Proteome_PDC000116</option>
289 <option value="CPTAC_Prospective_Colon_VU_Proteome_PDC000109">CPTAC_Prospective_Colon_VU_Proteome_PDC000109</option>
290 <option value="CPTAC_Prospective_Ovarian_JHU_Glycoproteome_PDC000251">CPTAC_Prospective_Ovarian_JHU_Glycoproteome_PDC000251</option>
291 <option value="CPTAC_Prospective_Ovarian_JHU_Proteome_PDC000110">CPTAC_Prospective_Ovarian_JHU_Proteome_PDC000110</option>
292 <option value="CPTAC_Prospective_Ovarian_PNNL_Phosphoproteome_PDC000119">CPTAC_Prospective_Ovarian_PNNL_Phosphoproteome_PDC000119</option>
293 <option value="CPTAC_Prospective_Ovarian_PNNL_Proteome_Qeplus_PDC000118">CPTAC_Prospective_Ovarian_PNNL_Proteome_Qeplus_PDC000118</option>
294 <option value="CPTAC_TCGA_Breast_Cancer_Phosphoproteome_PDC000174">CPTAC_TCGA_Breast_Cancer_Phosphoproteome_PDC000174</option>
295 <option value="CPTAC_TCGA_Breast_Cancer_Proteome_PDC000173">CPTAC_TCGA_Breast_Cancer_Proteome_PDC000173</option>
296 <option value="CPTAC_TCGA_Colon_Cancer_Proteome_PDC000111">CPTAC_TCGA_Colon_Cancer_Proteome_PDC000111</option>
297 <option value="CPTAC_TCGA_Ovarian_Glycoproteome_PDC000112">CPTAC_TCGA_Ovarian_Glycoproteome_PDC000112</option>
298 <option value="CPTAC_TCGA_Ovarian_Phosphoproteome_PDC000115">CPTAC_TCGA_Ovarian_Phosphoproteome_PDC000115</option>
299 <option value="CPTAC_TCGA_Ovarian_Proteome_PDC000113_PDC000114">CPTAC_TCGA_Ovarian_Proteome_PDC000113_PDC000114</option>
300 <option value="CPTAC_UCEC_Discovery_Study_Acetylome_PDC000226">CPTAC_UCEC_Discovery_Study_Acetylome_PDC000226</option>
301 <option value="CPTAC_UCEC_Discovery_Study_Phosphoproteome_PDC000126">CPTAC_UCEC_Discovery_Study_Phosphoproteome_PDC000126</option>
302 <option value="CPTAC_UCEC_Discovery_Study_Proteome_PDC000125">CPTAC_UCEC_Discovery_Study_Proteome_PDC000125</option>
303 <option value="Deep_29_healthy_human_tissues_PXD010154">Deep_29_healthy_human_tissues_PXD010154</option>
304 <option value="GTEx_32_Tissues_Proteome_PXD016999">GTEx_32_Tissues_Proteome_PXD016999</option>
305 <option value="HBV_Related_Hepatocellular_Carcinoma_Phosphoproteome_PDC000199">HBV_Related_Hepatocellular_Carcinoma_Phosphoproteome_PDC000199</option>
306 <option value="HBV_Related_Hepatocellular_Carcinoma_Proteome_PDC000198">HBV_Related_Hepatocellular_Carcinoma_Proteome_PDC000198</option>
307 <option value="Oral_Squamous_Cell_Carcinoma_Study_Proteome_PDC000262">Oral_Squamous_Cell_Carcinoma_Study_Proteome_PDC000262</option>
308 <option value="Proteogenomics_of_Gastric_Cancer_Glycoproteome_PDC000216">Proteogenomics_of_Gastric_Cancer_Glycoproteome_PDC000216</option>
309 <option value="Proteogenomics_of_Gastric_Cancer_Phosphoproteome_PDC000215">Proteogenomics_of_Gastric_Cancer_Phosphoproteome_PDC000215</option>
310 <option value="Proteogenomics_of_Gastric_Cancer_Proteome_PDC000214">Proteogenomics_of_Gastric_Cancer_Proteome_PDC000214</option>
311 </param> 262 </param>
312 </when> 263 </when>
313 <when value="public"> 264 <when value="public">
314 <param name="dataset" type="text" value="" label="Public dataset"> 265 <param name="dataset" type="text" value="" label="Public dataset">
315 <validator type="regex" message="An identifier strating with PXD or MSV or JPST">^(PXD|MSV|JPST).*$</validator> 266 <validator type="regex" message="An identifier strating with PXD or MSV or JPST">^(PXD|MSV|JPST).*$</validator>
321 <option value="1" selected="true">index (1-based) in MGF</option> 272 <option value="1" selected="true">index (1-based) in MGF</option>
322 <option value="2">spectrum title in MGF</option> 273 <option value="2">spectrum title in MGF</option>
323 </param> 274 </param>
324 </section> 275 </section>
325 276
326 <param name="parameter_set" argument="-p" type="text" value="" optional="true" label="MS/MS searching parameter set name"> 277 <param name="parameter_set" argument="-p" type="text" value="" optional="true" label="MS/MS searching parameter set name">
327 <help>Currently supported set names start with: MS1 or TMT</help> 278 <help>Currently supported set names start with: MS1 or TMT</help>
328 <option value="MS1_H_MS2_H_LF">MS1_H_MS2_H_LF</option> 279 <option value="MS1_H_MS2_H_LF">MS1_H_MS2_H_LF</option>
329 <option value="MS1_H_MS2_L_LF">MS1_H_MS2_L_LF</option> 280 <option value="MS1_H_MS2_L_LF">MS1_H_MS2_L_LF</option>
330 <option value="TMT10_11">TMT10_11</option> 281 <option value="TMT10_11">TMT10_11</option>
331 <option value="TMT10_11_MS2_L">TMT10_11_MS2_L</option> 282 <option value="TMT10_11_MS2_L">TMT10_11_MS2_L</option>
332 <option value="TMT10_11_MS2_L_phosphorylation">TMT10_11_MS2_L_phosphorylation</option> 283 <option value="TMT10_11_MS2_L_phosphorylation">TMT10_11_MS2_L_phosphorylation</option>
333 <option value="TMT10_11_acetylation">TMT10_11_acetylation</option> 284 <option value="TMT10_11_acetylation">TMT10_11_acetylation</option>
334 <option value="TMT10_11_glycosylation">TMT10_11_glycosylation</option> 285 <option value="TMT10_11_glycosylation">TMT10_11_glycosylation</option>
335 <option value="TMT10_11_phosphorylation">TMT10_11_phosphorylation</option> 286 <option value="TMT10_11_phosphorylation">TMT10_11_phosphorylation</option>
336 <option value="TMT10_11_ubiquitination">TMT10_11_ubiquitination</option> 287 <option value="TMT10_11_ubiquitination">TMT10_11_ubiquitination</option>
337 </param> 288 </param>
338 289
339 <!--
340 TMT10_11_MS2_L_phosphorylation
341 Fixed modification: 1,11,12 = Carbamidomethylation of C,TMT 10-plex of K,TMT 10-plex of peptide N-term
342 Variable modification: 2,7,8,9 = Oxidation of M,Phosphorylation of S,Phosphorylation of T,Phosphorylation of Y
343 Enzyme: 1
344 Max Missed cleavages: 1
345 Precursor mass tolerance: 20.0
346 Precursor ion mass tolerance unit: ppm
347 Fragment ion mass tolerance: 0.6
348 Fragment ion mass tolerance unit: Da
349 -->
350
351 <section name="modifications" title="Modifications" expanded="false"> 290 <section name="modifications" title="Modifications" expanded="false">
352 <param name="fixed_mod" argument="-fixMod" type="select" label="Fixed modification(s)" multiple="true" optional="true"> 291 <param name="fixed_mod" argument="-fixMod" type="select" label="Fixed modification(s)" multiple="true" optional="true">
353 <help>default: 1: Carbamidomethylation of C [57.02146372057]</help> 292 <help>default: 1: Carbamidomethylation of C [57.02146372057]</help>
354 <expand macro="modifications" /> 293 <expand macro="modifications" />
355 </param> 294 </param>
382 <param name="precursor_tolerance" argument="-tol" type="integer" value="" optional="true" label="Precursor Tolerance" help="The error window on experimental peptide mass values. This parameter is usually set according to the mass spectrometer which was used to generate the MS/MS data. Default: 10" /> 321 <param name="precursor_tolerance" argument="-tol" type="integer" value="" optional="true" label="Precursor Tolerance" help="The error window on experimental peptide mass values. This parameter is usually set according to the mass spectrometer which was used to generate the MS/MS data. Default: 10" />
383 <param name="precursor_unit" argument="-tolu" type="select" optional="true" label="Precursor Unit" help="The unit of precursor ion m/z tolerance"> 322 <param name="precursor_unit" argument="-tolu" type="select" optional="true" label="Precursor Unit" help="The unit of precursor ion m/z tolerance">
384 <option value="ppm" selected="true">ppm</option> 323 <option value="ppm" selected="true">ppm</option>
385 <option value="Da">Da</option> 324 <option value="Da">Da</option>
386 </param> 325 </param>
387 <param name="tolerance" argument="-itol" type="float" value="0.6" optional="true" label="Tolerance" help="Error window for MS/MS fragment ion mass values in Da unit. Default: 0.6 Da" /> 326 <param name="tolerance" argument="-itol" type="float" value="" optional="true" label="Tolerance" help="Error window for MS/MS fragment ion mass values in Da unit. Default: 0.6 Da" />
388 </section> 327 </section>
389 328
390 <section name="search" title="PSM" expanded="false"> 329 <section name="search" title="PSM" expanded="false">
391 <param name="frag_method" argument="-fragmentMethod" type="select" optional="true" label="Fragmentation Method"> 330 <param name="frag_method" argument="-fragmentMethod" type="select" optional="true" label="Fragmentation Method">
392 <option value="1" selected="true">CID/HCD</option> 331 <option value="1" selected="true">CID/HCD</option>
396 <option value="1" selected="true">HyperScore</option> 335 <option value="1" selected="true">HyperScore</option>
397 <option value="2">MVH</option> 336 <option value="2">MVH</option>
398 </param> 337 </param>
399 <param name="extra_score_validation" argument="-x" type="boolean" truevalue="-x" falsevalue="" checked="false" label="Add extra score validation" help="use two scoring algorithms for peptide identification" /> 338 <param name="extra_score_validation" argument="-x" type="boolean" truevalue="-x" falsevalue="" checked="false" label="Add extra score validation" help="use two scoring algorithms for peptide identification" />
400 <param name="min_charge" argument="-minCharge" type="integer" value="" optional="true" label="Minimum Charge" help="The minimum charge to consider if the charge state is not available. Default: 2"/> 339 <param name="min_charge" argument="-minCharge" type="integer" value="" optional="true" label="Minimum Charge" help="The minimum charge to consider if the charge state is not available. Default: 2"/>
401 <param name="max_charge" argument="-maxCharge" type="integer" value="" optional="true" label="Maximum Charge" help="The maximum charge to consider if the charge state is not available. Default: 2" /> 340 <param name="max_charge" argument="-maxCharge" type="integer" value="" optional="true" label="Maximum Charge" help="The maximum charge to consider if the charge state is not available. Default: 3" />
402 <param name="min_peaks" argument="-minPeaks" type="integer" value="" optional="true" label="Minimum Peaks" help="Min peaks in spectrum. Default: 10" /> 341 <param name="min_peaks" argument="-minPeaks" type="integer" value="" optional="true" label="Minimum Peaks" help="Min peaks in spectrum. Default: 10" />
403 <param name="isotope_error" argument="-ti" type="text" value="" optional="true" label="Isotope peak error range"> 342 <param name="isotope_error" argument="-ti" type="text" value="" optional="true" label="Isotope peak error range">
404 <help>A comma-sepated range of integers from -2 to 2, e.g. '-1,0,1,2' Default: 0</help> 343 <help>A comma-sepated range of integers from -2 to 2, e.g. '-1,0,1,2' Default: 0</help>
405 <validator type="regex" message="">^((-2,)?-1,)?0(,1(,2)?)?$</validator> 344 <validator type="regex" message="">^((-2,)?-1,)?0(,1(,2)?)?$</validator>
406 </param> 345 </param>
410 <param name="num_random_peptides" argument="-n" type="integer" value="" min="0" optional="true" label="Number of Random Peptides" help="The number of random peptides. Default: 1000" /> 349 <param name="num_random_peptides" argument="-n" type="integer" value="" min="0" optional="true" label="Number of Random Peptides" help="The number of random peptides. Default: 1000" />
411 </section> 350 </section>
412 </section> 351 </section>
413 352
414 <param name="outputs_selected" type="select" multiple="true" optional="false" label="Select outputs"> 353 <param name="outputs_selected" type="select" multiple="true" optional="false" label="Select outputs">
415 <option value="parameter.txt" selected="true">parameter.txt</option>
416 <option value="psm.txt" selected="true">psm.txt</option> 354 <option value="psm.txt" selected="true">psm.txt</option>
417 <option value="psm_rank.txt" selected="true">psm_rank.txt</option> 355 <option value="psm_rank.txt" selected="true">psm_rank.txt</option>
418 <option value="psm_rank.mgf" selected="true">psm_rank.mgf</option> 356 <option value="psm_rank.mgf" selected="true">psm_rank.mgf</option>
419 <option value="psm_annotation.txt" selected="true">psm_annotation.txt</option> 357 <option value="psm_annotation.txt" selected="true">psm_annotation.txt</option>
420 <option value="psm_type.txt" selected="false">psm_type.txt</option> 358 <option value="psm_type.txt" selected="false">psm_type.txt</option>
425 <option value="ms_index" selected="true">MS/MS Index</option> 363 <option value="ms_index" selected="true">MS/MS Index</option>
426 </param> 364 </param>
427 <param name="fast" argument="-fast" type="boolean" truevalue="-fast" falsevalue="" checked="false" label="Use fast mode for searching" help="In fast mode, only one better match from reference peptide-based competitive filtering steps will be returned. A peptide identified or not is not affected by this setting. For most applications, fast mode will speed up the analysis." /> 365 <param name="fast" argument="-fast" type="boolean" truevalue="-fast" falsevalue="" checked="false" label="Use fast mode for searching" help="In fast mode, only one better match from reference peptide-based competitive filtering steps will be returned. A peptide identified or not is not affected by this setting. For most applications, fast mode will speed up the analysis." />
428 </inputs> 366 </inputs>
429 <outputs> 367 <outputs>
368 <data name="parameter_txt" format="txt" from_work_dir="pepquery_output/parameter.txt" label="${tool.name} on ${on_string}: parameter.txt">
369 </data>
430 <data name="ms_index" format="txt" label="${tool.name} on ${on_string}: index summary.txt" from_work_dir="index_dir/summary.txt"> 370 <data name="ms_index" format="txt" label="${tool.name} on ${on_string}: index summary.txt" from_work_dir="index_dir/summary.txt">
431 <filter>'ms_index' in outputs_selected and req_inputs['ms_dataset']['ms_dataset_type'] == 'history'</filter> 371 <filter>'ms_index' in outputs_selected and req_inputs['ms_dataset']['ms_dataset_type'] == 'history'</filter>
432 </data> 372 </data>
433 <data name="parameter_txt" format="txt" from_work_dir="pepquery_output/parameter.txt" label="${tool.name} on ${on_string}: parameter.txt">
434 <filter>'parameter.txt' in outputs_selected</filter>
435 </data>
436
437 <data name="psm_txt" format="tabular" from_work_dir="pepquery_output/psm.txt" label="${tool.name} on ${on_string}: psm.txt"> 373 <data name="psm_txt" format="tabular" from_work_dir="pepquery_output/psm.txt" label="${tool.name} on ${on_string}: psm.txt">
438 <filter>'psm.txt' in outputs_selected</filter> 374 <filter>'psm.txt' in outputs_selected</filter>
439 <actions> 375 <actions>
440 <action name="comment_lines" type="metadata" default="1" /> 376 <action name="comment_lines" type="metadata" default="1" />
441 <action name="column_names" type="metadata" default="peptide,modification,n,spectrum_title,charge,exp_mass,tol_ppm,tol_da,isotope_error,pep_mass,mz,score,n_db,total_db,n_random,total_random,pvalue" /> 377 <action name="column_names" type="metadata" default="peptide,modification,n,spectrum_title,charge,exp_mass,tol_ppm,tol_da,isotope_error,pep_mass,mz,score,n_db,total_db,n_random,total_random,pvalue" />
490 </actions> 426 </actions>
491 </data> 427 </data>
492 428
493 </outputs> 429 </outputs>
494 <tests> 430 <tests>
495 <!-- Test-1 --> 431 <!-- Test-1 PepQueryDB peptide gencode:human -->
496 <!--
497 <test> 432 <test>
433 <conditional name="validation">
434 <param name="task_type" value="novel"/>
435 </conditional>
436 <section name="req_inputs">
437 <conditional name="input_type">
438 <param name="input_type_selector" value="peptide"/>
439 <conditional name="multiple">
440 <param name="peptide_input_selector" value="single" />
441 <param name="input" value="LVVVGADGVGK"/>
442 </conditional>
443 </conditional>
444 <conditional name="db_type">
445 <param name="db_type_selector" value="download" />
446 <param name="db_id" value="gencode:human"/>
447 </conditional>
448 <conditional name="ms_dataset">
449 <param name="ms_dataset_type" value="PepQueryDB"/>
450 <param name="dataset" value="CPTAC_LUAD_Discovery_Study_Proteome_PDC000153" />
451 </conditional>
452 <param name="indexType" value="1"/>
453 </section>
454 <param name="parameter_set" value=""/>
455 <section name="modifications">
456 <param name="fixed_mod" value="1"/>
457 <param name="var_mod" value="2"/>
458 <param name="max_mods" value="3"/>
459 <param name="unmodified" value="True"/>
460 <param name="aa" value="False"/>
461 </section>
462 <section name="digestion">
463 <param name="enzyme" value="1"/>
464 <param name="max_missed_cleavages" value="2"/>
465 </section>
466 <section name="ms_params">
467 <section name="tolerance_params">
468 <param name="precursor_tolerance" value="10"/>
469 <param name="precursor_unit" value="ppm"/>
470 <param name="tolerance" value="0.6"/>
471 </section>
472 <section name="search">
473 <param name="frag_method" value="1"/>
474 <param name="scoring_method" value="1"/>
475 <param name="extra_score_validation" value="False"/>
476 <param name="min_charge" value="2"/>
477 <param name="max_charge" value="3"/>
478 <param name="min_peaks" value="10"/>
479 <param name="isotope_error" value="0"/>
480 <param name="min_score" value="12"/>
481 <param name="min_length" value="7"/>
482 <param name="max_length" value="45"/>
483 <param name="num_random_peptides" value="1000"/>
484 </section>
485 </section>
486 <output name="psm_txt">
487 <assert_contents>
488 <has_text text="LVVVGADGVGK" />
489 <has_text text="02CPTAC_LUAD_W_BI_20180518_KR_f15:25149:2" />
490 </assert_contents>
491 </output>
492 </test>
493
494 <!-- Test-2 MGF peptide Uniprot.fasta -->
495 <test>
496 <conditional name="validation">
497 <param name="task_type" value="novel"/>
498 </conditional>
498 <section name="req_inputs"> 499 <section name="req_inputs">
499 <conditional name="input_type"> 500 <conditional name="input_type">
500 <param name="input_type_selector" value="peptide"/> 501 <param name="input_type_selector" value="peptide"/>
501 <conditional name="multiple"> 502 <conditional name="multiple">
502 <param name="peptide_input_selector" value="single" /> 503 <param name="peptide_input_selector" value="single" />
503 <param name="input" value="ELGSSDLTAR"/> 504 <param name="input" value="ELGSSDLTAR"/>
504 </conditional> 505 </conditional>
505 </conditional> 506 </conditional>
506 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/> 507 <conditional name="db_type">
507 <param name="spectrum_file" ftype="mgf" value="iTRAQ_f4.mgf"/> 508 <param name="db_type_selector" value="history" />
508 </section> 509 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
510 </conditional>
511 <conditional name="ms_dataset">
512 <param name="ms_dataset_type" value="history"/>
513 <param name="spectrum_files" ftype="mgf" value="iTRAQ_f4.mgf"/>
514 </conditional>
515 <param name="indexType" value="1"/>
516 </section>
517 <param name="parameter_set" value=""/>
509 <section name="modifications"> 518 <section name="modifications">
510 <param name="fixed_mod" value="6,103,157"/> 519 <!-- 21: iTRAQ 4-plex of K [144.1020624208] -->
511 <param name="var_mod" value="117"/> 520 <!-- 22: iTRAQ 4-plex of peptide N-term [144.1020624208] -->
521 <param name="fixed_mod" value="1,21,22"/>
522 <!-- 2: Oxidation of M [15.99491461956] -->
523 <param name="var_mod" value="2"/>
512 <param name="max_mods" value="3"/> 524 <param name="max_mods" value="3"/>
513 <param name="unmodified" value="False"/> 525 <param name="unmodified" value="True"/>
514 <param name="aa" value="True"/> 526 <param name="aa" value="False"/>
527 </section>
528 <section name="digestion">
529 <param name="enzyme" value="1"/>
530 <param name="max_missed_cleavages" value="2"/>
515 </section> 531 </section>
516 <section name="ms_params"> 532 <section name="ms_params">
517 <section name="tolerance_params"> 533 <section name="tolerance_params">
518 <param name="precursor_tolerance" value="10"/> 534 <param name="precursor_tolerance" value="10"/>
519 <param name="precursor_unit" value="ppm"/> 535 <param name="precursor_unit" value="ppm"/>
520 <param name="tolerance" value="0.6"/> 536 <param name="tolerance" value="0.6"/>
521 </section> 537 </section>
522 <section name="digestion">
523 <param name="enzyme" value="0"/>
524 <param name="max_missed_cleavages" value="2"/>
525 </section>
526 <section name="search"> 538 <section name="search">
527 <param name="frag_method" value="1"/> 539 <param name="frag_method" value="1"/>
528 <param name="scoring_method" value="1"/> 540 <param name="scoring_method" value="1"/>
541 <param name="extra_score_validation" value="False"/>
542 <param name="min_charge" value="2"/>
529 <param name="max_charge" value="3"/> 543 <param name="max_charge" value="3"/>
530 <param name="min_charge" value="2"/>
531 <param name="min_peaks" value="10"/> 544 <param name="min_peaks" value="10"/>
545 <param name="isotope_error" value="0"/>
532 <param name="min_score" value="12"/> 546 <param name="min_score" value="12"/>
547 <param name="min_length" value="7"/>
533 <param name="max_length" value="45"/> 548 <param name="max_length" value="45"/>
534 <param name="num_random_peptides" value="1000"/> 549 <param name="num_random_peptides" value="1000"/>
535 </section> 550 </section>
536 </section> 551 </section>
537 <output name="psm_rank_txt"> 552 <output name="psm_txt">
538 <assert_contents>
539 <has_text text="ELGSSDLTAR" />
540 <has_line_matching expression="ELGSSDLTAR\tiTRAQ 4-plex of peptide N-term@0\S+\t2\tiTRAQ_f4.mgf\t2\t2\t1191.6\d+\t2.0\d+\t1191.62\d+\t596.81\d+\t18.68\d+\t0\t20\t5\t995\t0.006\d+\t1"/>
541 </assert_contents>
542 </output>
543 </test>
544 -->
545
546 <!-- Test-2 -->
547 <!--
548 <test>
549 <section name="req_inputs">
550 <conditional name="input_type">
551 <param name="input_type_selector" value="peptide"/>
552 <conditional name="multiple">
553 <param name="peptide_input_selector" value="multiple" />
554 <param name="input" ftype="tabular" value="novel_peptides"/>
555 </conditional>
556 </conditional>
557 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
558 <param name="spectrum_file" ftype="mgf" value="iTRAQ_f4.mgf"/>
559 </section>
560 <section name="modifications">
561 <param name="fixed_mod" value="6,103,157"/>
562 <param name="var_mod" value="117"/>
563 <param name="max_mods" value="3"/>
564 <param name="unmodified" value="False"/>
565 <param name="aa" value="True"/>
566 </section>
567 <section name="ms_params">
568 <section name="tolerance_params">
569 <param name="precursor_tolerance" value="10"/>
570 <param name="precursor_unit" value="ppm"/>
571 <param name="tolerance" value="0.6"/>
572 </section>
573 <section name="digestion">
574 <param name="enzyme" value="0"/>
575 <param name="max_missed_cleavages" value="2"/>
576 </section>
577 <section name="search">
578 <param name="frag_method" value="1"/>
579 <param name="scoring_method" value="1"/>
580 <param name="max_charge" value="3"/>
581 <param name="min_charge" value="2"/>
582 <param name="min_peaks" value="10"/>
583 <param name="min_score" value="12"/>
584 <param name="max_length" value="45"/>
585 <param name="num_random_peptides" value="1000"/>
586 </section>
587 </section>
588 <output name="psm_rank_txt">
589 <assert_contents>
590 <has_text text="ELGSSDLTAR" />
591 <has_text text="SPYREFTDHLVK" />
592 <has_line_matching expression="SPYREFTDHLVK\tiTRAQ 4-plex of K@12\S+;iTRAQ 4-plex of peptide N-term@0\S+\t1\tiTRAQ_f4.mgf\t4\t3\t1778.\d+\t3.02\d+\t1778.95\d+\t593.99\d+\t12.17\d+\t2\t14\t-1\t-1\t100.0\t1"/>
593 </assert_contents>
594 </output>
595 </test>
596 -->
597
598 <!-- Test-3 -->
599 <!--
600 <test>
601 <section name="req_inputs">
602 <conditional name="input_type">
603 <param name="input_type_selector" value="peptide"/>
604 <conditional name="multiple">
605 <param name="peptide_input_selector" value="multiple" />
606 <param name="input" ftype="tabular" value="novel_peptides"/>
607 </conditional>
608 </conditional>
609 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
610 <param name="spectrum_file" ftype="mgf" value="iTRAQ_f4.mgf"/>
611 </section>
612 <section name="modifications">
613 <param name="fixed_mod" value="6,103,157"/>
614 <param name="var_mod" value="117"/>
615 <param name="max_mods" value="3"/>
616 <param name="unmodified" value="True"/>
617 <param name="aa" value="True"/>
618 </section>
619 <section name="ms_params">
620 <section name="tolerance_params">
621 <param name="precursor_tolerance" value="10"/>
622 <param name="precursor_unit" value="ppm"/>
623 <param name="tolerance" value="0.6"/>
624 </section>
625 <section name="digestion">
626 <param name="enzyme" value="0"/>
627 <param name="max_missed_cleavages" value="1"/>
628 </section>
629 <section name="search">
630 <param name="frag_method" value="1"/>
631 <param name="scoring_method" value="1"/>
632 <param name="max_charge" value="3"/>
633 <param name="min_charge" value="2"/>
634 <param name="min_peaks" value="7"/>
635 <param name="min_score" value="10"/>
636 <param name="max_length" value="45"/>
637 <param name="num_random_peptides" value="1000"/>
638 </section>
639 </section>
640 <output name="psm_rank_txt">
641 <assert_contents>
642 <has_text text="ELGSSDLTAR" />
643 <has_text text="SPYREFTDHLVK" />
644 <has_line_matching expression="ELGSSDLTAR\tiTRAQ 4-plex of peptide N-term@0\S+\t2\t3\t2\t1191.6\d+\t-3.04\d+\t1191.62\d+\t596.8\d+\t24.18\d+\t0\t22\t1\t995\t0.002\d+\t1\t0\tYes" />
645 </assert_contents>
646 </output>
647 </test>
648 -->
649
650 <!-- Test-4 -->
651 <!--
652 <test>
653 <section name="req_inputs">
654 <conditional name="input_type">
655 <param name="input_type_selector" value="1"/>
656 <conditional name="multiple">
657 <param name="protein_input_selector" value="multiple" />
658 <param name="input" ftype="fasta" value="novel_proteins.fa"/>
659 </conditional>
660 </conditional>
661 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
662 <param name="spectrum_file" ftype="mgf" value="iTRAQ_f4.mgf"/>
663 </section>
664 <section name="modifications">
665 <param name="fixed_mod" value="6,103,157"/>
666 <param name="var_mod" value="117"/>
667 <param name="max_mods" value="3"/>
668 <param name="unmodified" value="False"/>
669 <param name="aa" value="True"/>
670 </section>
671 <section name="ms_params">
672 <section name="tolerance_params">
673 <param name="precursor_tolerance" value="10"/>
674 <param name="precursor_unit" value="ppm"/>
675 <param name="tolerance" value="0.6"/>
676 </section>
677 <section name="digestion">
678 <param name="enzyme" value="0"/>
679 <param name="max_missed_cleavages" value="2"/>
680 </section>
681 <section name="search">
682 <param name="frag_method" value="1"/>
683 <param name="scoring_method" value="1"/>
684 <param name="max_charge" value="3"/>
685 <param name="min_charge" value="2"/>
686 <param name="min_peaks" value="10"/>
687 <param name="min_score" value="12"/>
688 <param name="max_length" value="45"/>
689 <param name="num_random_peptides" value="1000"/>
690 </section>
691 </section>
692 <output name="psm_rank_txt">
693 <assert_contents>
694 <has_text text="ELGSSDLTAR" />
695 <has_text text="SPYREFTDHLVK" />
696 </assert_contents>
697 </output>
698 </test>
699 -->
700
701 <!-- Test-5 -->
702 <!--
703 <test>
704 <section name="req_inputs">
705 <conditional name="input_type">
706 <param name="input_type_selector" value="2"/>
707 <param name="input" value="gaactgggcagcagcgatctgaccgcgcgcagcccgtatcgcgaatttaccgatcatctggtgaaa"/>
708 </conditional>
709 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
710 <param name="spectrum_file" ftype="mgf" value="iTRAQ_f4.mgf"/>
711 </section>
712 <section name="modifications">
713 <param name="fixed_mod" value="6,103,157"/>
714 <param name="var_mod" value="117"/>
715 <param name="max_mods" value="3"/>
716 <param name="unmodified" value="False"/>
717 <param name="aa" value="True"/>
718 </section>
719 <section name="ms_params">
720 <section name="tolerance_params">
721 <param name="precursor_tolerance" value="10"/>
722 <param name="precursor_unit" value="ppm"/>
723 <param name="tolerance" value="0.6"/>
724 </section>
725 <section name="digestion">
726 <param name="enzyme" value="0"/>
727 <param name="max_missed_cleavages" value="2"/>
728 </section>
729 <section name="search">
730 <param name="frag_method" value="1"/>
731 <param name="scoring_method" value="1"/>
732 <param name="max_charge" value="3"/>
733 <param name="min_charge" value="2"/>
734 <param name="min_peaks" value="10"/>
735 <param name="min_score" value="12"/>
736 <param name="max_length" value="45"/>
737 <param name="num_random_peptides" value="1000"/>
738 </section>
739 </section>
740 <output name="psm_rank_txt">
741 <assert_contents> 553 <assert_contents>
742 <has_text text="ELGSSDLTAR" /> 554 <has_text text="ELGSSDLTAR" />
743 </assert_contents> 555 </assert_contents>
744 </output> 556 </output>
745 </test>
746 -->
747
748 <!-- Test-6 -->
749 <!--
750 <test>
751 <section name="req_inputs">
752 <conditional name="input_type">
753 <param name="input_type_selector" value="peptide"/>
754 <conditional name="multiple">
755 <param name="peptide_input_selector" value="multiple" />
756 <param name="input" ftype="tabular" value="novel_peptides"/>
757 </conditional>
758 </conditional>
759 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
760 <param name="spectrum_file" ftype="mgf" value="immunopeptidomics.mgf"/>
761 <param name="indexType" value="2"/>
762 <conditional name="tags">
763 <param name="tagType" value="PepQuery"/>
764 <param name="tag_file" ftype="tabular" value="test.tags"/>
765 <param name="tagIndexType" value="2"/>
766 </conditional>
767 </section>
768 <section name="modifications">
769 <param name="fixed_mod" value=""/>
770 <param name="var_mod" value="117,114,118,128"/>
771 <param name="max_mods" value="3"/>
772 <param name="unmodified" value="True"/>
773 <param name="aa" value="True"/>
774 </section>
775 <section name="ms_params">
776 <section name="tolerance_params">
777 <param name="precursor_tolerance" value="20"/>
778 <param name="precursor_unit" value="ppm"/>
779 <param name="tolerance" value="0.02"/>
780 </section>
781 <section name="digestion">
782 <param name="enzyme" value="0"/>
783 <param name="max_missed_cleavages" value="0"/>
784 </section>
785 <section name="search">
786 <param name="frag_method" value="1"/>
787 <param name="scoring_method" value="1"/>
788 <param name="max_charge" value="3"/>
789 <param name="min_charge" value="2"/>
790 <param name="min_peaks" value="10"/>
791 <param name="min_score" value="12"/>
792 <param name="max_length" value="25"/>
793 <param name="num_random_peptides" value="1000"/>
794 </section>
795 </section>
796 <output name="psm_rank_txt"> 557 <output name="psm_rank_txt">
797 <assert_contents> 558 <assert_contents>
798 <has_text text="MTDRHAGTY" /> 559 <has_text text="ELGSSDLTAR" />
799 <has_text text="controllerType=0 controllerNumber=1 scan=19905" /> 560 <has_line_matching expression="ELGSSDLTAR\tiTRAQ 4-plex of peptide N-term@0\[144.1\d+\]\t2\tiTRAQ_f4:3:2\t2\t1191.62\d+\t-3.04\d+\t-0.003\d+\t0.0\t1191.6\d+\t596.8\d+\t24.1\d+\t0\t0\t1\t995\t0.002\d+\t1\t0\tYes\t24.1\d+\t24.1\d+"/>
800 </assert_contents> 561 </assert_contents>
801 </output> 562 </output>
802 </test> 563 </test>
803 -->
804
805 <!-- Test-7 -->
806 <!--
807 <test>
808 <section name="req_inputs">
809 <conditional name="input_type">
810 <param name="input_type_selector" value="peptide"/>
811 <conditional name="multiple">
812 <param name="peptide_input_selector" value="multiple" />
813 <param name="input" ftype="tabular" value="novel_peptides"/>
814 </conditional>
815 </conditional>
816 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
817 <param name="spectrum_file" ftype="mgf" value="immunopeptidomics.mgf"/>
818 <param name="indexType" value="2"/>
819 <conditional name="tags">
820 <param name="tagType" value="pFind"/>
821 <param name="qry_res" ftype="txt" value="pFind.qry.res"/>
822 </conditional>
823 </section>
824 <section name="modifications">
825 <param name="fixed_mod" value=""/>
826 <param name="var_mod" value="117,114,118,128"/>
827 <param name="max_mods" value="3"/>
828 <param name="unmodified" value="True"/>
829 <param name="aa" value="True"/>
830 </section>
831 <section name="ms_params">
832 <section name="tolerance_params">
833 <param name="precursor_tolerance" value="20"/>
834 <param name="precursor_unit" value="ppm"/>
835 <param name="tolerance" value="0.02"/>
836 </section>
837 <section name="digestion">
838 <param name="enzyme" value="0"/>
839 <param name="max_missed_cleavages" value="0"/>
840 </section>
841 <section name="search">
842 <param name="frag_method" value="1"/>
843 <param name="scoring_method" value="1"/>
844 <param name="max_charge" value="3"/>
845 <param name="min_charge" value="2"/>
846 <param name="min_peaks" value="10"/>
847 <param name="min_score" value="12"/>
848 <param name="max_length" value="25"/>
849 <param name="num_random_peptides" value="1000"/>
850 </section>
851 </section>
852 <output name="psm_rank_txt">
853 <assert_contents>
854 <has_text text="MTDRHAGTY" />
855 <has_text text="controllerType=0 controllerNumber=1 scan=19905" />
856 </assert_contents>
857 </output>
858 </test>
859 -->
860 564
861 </tests> 565 </tests>
862 <help><![CDATA[ 566 <help><![CDATA[
863 **PepQuery** 567 **PepQuery2**
864 568
865 PepQuery_ is a universal targeted peptide search engine for identifying or validating known and novel peptides of interest in any local or publicly available mass spectrometry-based proteomics datasets. 569 PepQuery_ is a universal targeted peptide search engine for identifying or validating known and novel peptides of interest in any local or publicly available mass spectrometry-based proteomics datasets.
866 570
867 571
868 PepQuery_ is a peptide-centric search engine for novel peptide identification and validation. Cancer genomics studies have identified a large number of genomic alterations that may lead to novel, cancer-specific protein sequences. Proteins resulted from these genomic alterations are attractive candidates for cancer biomarkers and therapeutic targets. The leading approach to proteomic validation of genomic alterations is to analyze tandem mass spectrometry (MS/MS) data using customized proteomics databases created from genomics data. Such analysis is time-consuming and requires thorough training and detailed knowledge in proteomics data analysis, leading to a gap between MS/MS data and the cancer genomics community. PepQuery does not require customized databases and allows quick and easy proteomic validation of genomic alterations. 572 PepQuery_ is a peptide-centric search engine for novel peptide identification and validation. Cancer genomics studies have identified a large number of genomic alterations that may lead to novel, cancer-specific protein sequences. Proteins resulted from these genomic alterations are attractive candidates for cancer biomarkers and therapeutic targets. The leading approach to proteomic validation of genomic alterations is to analyze tandem mass spectrometry (MS/MS) data using customized proteomics databases created from genomics data. Such analysis is time-consuming and requires thorough training and detailed knowledge in proteomics data analysis, leading to a gap between MS/MS data and the cancer genomics community. PepQuery does not require customized databases and allows quick and easy proteomic validation of genomic alterations.
870 PepQuery2 leverages a new MS/MS indexing approach and cloud storage to enable ultrafast, targeted identification of both novel and known peptides. PepQuery2 allows users to search more than one billion MS/MS data indexed in the PepQueryDB from any computers with internet access. It also supports direct analysis of user provided MS/MS data, any public datasets in PRIDE, MassIVE, jPOSTrepo and iProX, or Universal Spectrum Identifiers (USIs) from ProteomeXchange. 574 PepQuery2 leverages a new MS/MS indexing approach and cloud storage to enable ultrafast, targeted identification of both novel and known peptides. PepQuery2 allows users to search more than one billion MS/MS data indexed in the PepQueryDB from any computers with internet access. It also supports direct analysis of user provided MS/MS data, any public datasets in PRIDE, MassIVE, jPOSTrepo and iProX, or Universal Spectrum Identifiers (USIs) from ProteomeXchange.
871 575
872 **Inputs** 576 **Inputs**
873 - A sequence to match, one of the following: 577 - A sequence to match, one of the following:
874 578
875 - A peptide string or a history dataset with a list of peptides 579 - A peptide string (or strings separated by commas)
580 - A history dataset with a list of peptides
876 - A protein string or a history dataset with a protein fasta 581 - A protein string or a history dataset with a protein fasta
877 - A DNA string that is at least 60 base pairs in length 582 - A DNA string that is at least 60 base pairs in length
878 583
879 - MS/MS data used for identification: 584
880 585 - MS/MS data used for identification, one of the following:
881 - A mass spectrometry history datasets in MGF, mzML, or mzXML format 586
882 - An Indexed MS/MS dataset 587 - Mass Spectrometry history datasets in MGF, mzML, or mzXML format
588 - An Indexed MS/MS dataset (from previous PepQuery2 run or from **PepQuery2 index** tool.)
883 - PepQueryDB dataset IDs 589 - PepQueryDB dataset IDs
590
591 ..
592
593 Multiple datasets from PepQueryDB must be separated by comma. A pattern to match datasets in PepQueryDB is also supported, for example, use 'CPTAC' to search all datasets contain 'CPTAC'. In addition, dataset selection from PepQueryDB based on data type (w:global proteome, p:phosphorylation, a:acetylation, u:ubiquitination, g:glycosylation) is also supported. For example, use 'p' to search all phosphoproteomics datasets in PepQueryDB. The **PepQuery2 Show Sets** tool will list available PepQueryDB datasets.
594
595
884 - Dataset IDs from public proteomics data repositories: PRIDE, MassIVE, jPOSTrepo and iProX 596 - Dataset IDs from public proteomics data repositories: PRIDE, MassIVE, jPOSTrepo and iProX
597
598 ..
599
600 Dataset ID from public proteomics data repositories, one dataset is supported for each analysis. For example, use 'PXD000529' to use all MS/MS data from dataset PXD000529 or use 'PXD000529:LM3' to use data files containing LM3 from dataset PXD000529
885 601
886 - A reference protein fasta database, novel peptides matching a reference sequence will be excluded. 602 - A reference protein fasta database, novel peptides matching a reference sequence will be excluded.
887 603
888 - A protein fasta file 604 - A protein fasta file
889 - The ID for a public reference protein database from RefSeq, GENCODE, Ensembl or UniProt. 605 - The ID for a public reference protein database from RefSeq, GENCODE, Ensembl or UniProt.
890 606
607
608 **Options**
609
610 - MS/MS searching parameter set name
611
612 ..
613
614 Setting a *parameter set name* will change defaults for various options, These may be overridden by manually setting the option.
615 The **PepQuery2 Show Sets** tool *PepQuery Predefined Parameter Sets* will list those available along with the option values that will be set.
616 The **PepQuery2 Show Sets** tool *PepQuery Datasets* column *parameter_set* column for each PepQueryDB dataset.
617
618
619 - Override default options
620
621 ..
622
623 Values for modifications are provided in a select list.
624 The **PepQuery2 Show Sets** tool *PepQuery Modifications* lists all available modifications.
891 625
892 **Outputs** 626 **Outputs**
893 - Parameters: 627 - Parameters:
894 628
895 - parameters used in the search 629 - parameters used in the search