comparison FastQC/rgFastQC.xml @ 0:42251cbdeeac draft

Initial commit of test for FastQC with installation of the java stuff
author fubar
date Mon, 03 Jun 2013 20:30:24 -0400
parents
children c13fa2748191
comparison
equal deleted inserted replaced
-1:000000000000 0:42251cbdeeac
1 <tool name="FastQC: Comprehensive QC" id="fastqc" version="0.53">
2 <description>reporting for short read sequence</description>
3 <command interpreter="python">
4 rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$FASTQC_INSTALL_PATH/fastqc"
5 #if $contaminants.dataset and str($contaminants) > ''
6 -c "$contaminants"
7 #end if
8 </command>
9 <requirements>
10 <requirement type="set_environment">FASTQC_INSTALL_PATH</requirement>
11 <requirement type="package" version="0.10.1">FastQC</requirement>
12 </requirements>
13 <inputs>
14 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
15 <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80"
16 help="Letters and numbers only please - other characters will be removed">
17 <sanitizer invalid_char="">
18 <valid initial="string.letters,string.digits"/>
19 </sanitizer>
20 </param>
21 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
22 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
23 </inputs>
24 <outputs>
25 <data format="html" name="html_file" label="${out_prefix}_${input_file.name}.html" />
26 </outputs>
27 <tests>
28 <test>
29 <param name="input_file" value="1000gsample.fastq" />
30 <param name="out_prefix" value="fastqc_out" />
31 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
32 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
33 </test>
34 </tests>
35 <help>
36
37 .. class:: infomark
38
39 **Purpose**
40
41 FastQC aims to provide a simple way to do some quality control checks on raw
42 sequence data coming from high throughput sequencing pipelines.
43 It provides a modular set of analyses which you can use to give a quick
44 impression of whether your data has any problems of
45 which you should be aware before doing any further analysis.
46
47 The main functions of FastQC are:
48
49 - Import of data from BAM, SAM or FastQ files (any variant)
50 - Providing a quick overview to tell you in which areas there may be problems
51 - Summary graphs and tables to quickly assess your data
52 - Export of results to an HTML based permanent report
53 - Offline operation to allow automated generation of reports without running the interactive application
54
55
56 -----
57
58
59 .. class:: infomark
60
61 **FastQC**
62
63 This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_
64 Kindly acknowledge it as well as this tool if you use it.
65 FastQC incorporates the Picard-tools_ libraries for sam/bam processing.
66
67 The contaminants file parameter was borrowed from the independently developed
68 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
69
70 -----
71
72 .. class:: infomark
73
74 **Inputs and outputs**
75
76 FastQC_ is the best place to look for documentation - it's very good.
77 A summary follows below for those in a tearing hurry.
78
79 This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.
80 It will also take an optional file containing a list of contaminants information, in the form of
81 a tab-delimited file with 2 columns, name and sequence.
82
83 The tool produces a single HTML output file that contains all of the results, including the following:
84
85 - Basic Statistics
86 - Per base sequence quality
87 - Per sequence quality scores
88 - Per base sequence content
89 - Per base GC content
90 - Per sequence GC content
91 - Per base N content
92 - Sequence Length Distribution
93 - Sequence Duplication Levels
94 - Overrepresented sequences
95 - Kmer Content
96
97 All except Basic Statistics and Overrepresented sequences are plots.
98 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
99 .. _Picard-tools: http://picard.sourceforge.net/index.shtml
100
101 </help>
102 </tool>