Mercurial > repos > drosofff > yet_another_clipper
diff YAC/yac.xml @ 5:ad813be00215 draft default tip
Uploaded
author | drosofff |
---|---|
date | Sat, 31 May 2014 15:12:15 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/YAC/yac.xml Sat May 31 15:12:15 2014 -0400 @@ -0,0 +1,58 @@ + <tool id="yac" name="Clip adapter" version="1.0.0"> + <description></description> + <command interpreter="python">yac.py $input $output $clip_source.clip_sequence $min $max $Nmode</command> + <inputs> + <param format="fastq" name="input" type="data" label="Source file"/> + <param name="min" type="integer" size="4" value="15" label="min size"/> + <param name="max" type="integer" size="4" value="36" label="max size"/> + <param name="Nmode" type="select" label="Reads containing Nst"> + <option value="accept" selected="True">accept</option> + <option value="reject">reject</option> + </param> + <conditional name="clip_source"> + <param name="clip_source_list" type="select" label="Source" help="Built-in adapters or User-provided"> + <option value="prebuilt" selected="True">Use a built-in adapter (select from the list below)</option> + <option value="user">Use custom sequence</option> + </param> + <when value="prebuilt"> + <param name="clip_sequence" type="select" label="Select Adapter to clip" help="if your adapter is not listed, input your own sequence"> + <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option> + <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option> + <option value="TGGAATTCTCGGGTGCCAAG" selected="True">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option> + <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option> + </param> + </when> + <when value="user"> + <param name="clip_sequence" type="text" size="35" label="Enter your Sequence" value="GAATCC"/> + </when> + </conditional> + </inputs> + <outputs> + <data format="fasta" name="output" metadata="input" /> + </outputs> + + <help> +<!-- write a decent doc ! --> +This tool clips adapter sequences from a fastq file and fasta file of clipped reads with renumbered fasta headers. + +Clipped sequences with Ns can be discarded. + +Min size and max size filter clipped reads on their size. + +Note that unclipped reads that satisfy the min and max size conditions are kept. + </help> + +<!-- write a <test> section --> + <tests> + <test> + <param name="input" value="yac.fastq" ftype="fastqsanger"/> + <param name="min" value="18" /> + <param name="max" value="29" /> + <param name="clip_source_list" value="prebuilt" /> + <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" /> + <param name="Nmode" value="accept" /> + <output name="output" file="yac.out" /> + </test> + </tests> + +</tool>