Mercurial > repos > drosofff > msp_sr_size_histograms
view size_histogram.xml @ 5:27c1327f5687 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/msp_sr_size_histograms commit fe40dec87779c1fcfbd03330e653aa886f4a2cda
author | drosofff |
---|---|
date | Wed, 21 Oct 2015 11:40:35 -0400 |
parents | f0b489448615 |
children | 51a70c8da2bd |
line wrap: on
line source
<tool id="Size_histogram" name="Generate size histograms from alignment files" version="0.9.7"> <description>from sRbowtie aligment</description> <requirements> <requirement type="package" version="0.12.7">bowtie</requirement> <requirement type="package" version="0.7.7">pysam</requirement> <requirement type="package" version="3.1.2">R</requirements> <requirement type="package" version="2.14">biocbasics</requirement> <requirement type="package" version="1.9">numpy</requirement> </requirements> <command interpreter="python"> size_histogram.py #if $refGenomeSource.genomeSource == "history": --reference_fasta ## sys.argv[2] $refGenomeSource.ownFile ## index source #else: #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] --reference_bowtie_index $reference #end if --rcode $plotCode --output_size_distribution $size_distribution_dataframe --minquery $minquery --maxquery $maxquery --input #for $i in $refGenomeSource.series $i.input #end for --ext #for $i in $refGenomeSource.series $i.input.ext #end for --label #for $i in $refGenomeSource.series "$i.input.name" #end for --normalization_factor #for $i in $refGenomeSource.series $i.norm #end for #if $gff: --gff $gff #end if #if $global.value == 'yes': --global_size #end if #if $collapsestrands.value == 'yes': --collapse #end if </command> <inputs> <conditional name="refGenomeSource"> <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> <option value="indexed">Use a built-in index</option> <option value="history">Use one from the history</option> </param> <when value="indexed"> <repeat name="series" title="Add alignment files"> <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"> <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> </param> <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> </repeat> </when> <when value="history"> <param name="ownFile" type="data" format="fasta" label="Select a fasta file, to serve as index reference" /> <repeat name="series" title="Add alignment files"> <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"/> <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> </repeat> </when> </conditional> <param name="gff" type="data" format="gff,gff3" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> <param name="global" type="select" label="Generate size distribution for each item, or generate a global alignment"> <option value="no">for each item</option> <option value="yes">global</option> </param> <param name="collapsestrands" type="select" label="Whether + and - reads should be collapsed or not"> <option value="no">Do not collapse</option> <option value="yes">Collapse + and - reads</option> </param> <param name="minquery" type="integer" size="3" value="18" label="Min size of reads to plot" help="'15' = 15 nucleotides"/> <param name="maxquery" type="integer" size="3" value="28" label="Max size of reads to plot" help="'30' = 30 nucleotides"/> <param name="title" type="text" size="15" value="Size distribution" label="Main Titles"/> <param name="xlabel" type="text" size="15" value="Size in nucleotides" label="x axis label"/> <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> </param> </inputs> <configfiles> <configfile name="plotCode"> ## Setup R error handling to go to stderr options( show.error.messages=F, error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) library(RColorBrewer) library(lattice) library(latticeExtra) library(grid) library(gridExtra) ##cheetahtemplate data frame implementation size=read.delim("${size_distribution_dataframe}", header=T, row.names=NULL) n_samples = length(unique (size\$sample)) n_genes = length (unique (levels(size\$gene))) par.settings.size=list(layout.heights=list(top.padding=1, bottom.padding=1), strip.background = list(col = c("lightblue", "lightgreen")) ) smR.prepanel=function(x,y,...){; yscale=c(-max(abs(y)), max(abs(y)));list(ylim=yscale);} # use if one want y axis in the middle of the plot plot_size_distribution= function(df, ...) { bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample))+gene, data = df, origin = 0, horizontal=FALSE, group=polarity, stack=TRUE, col=c('red', 'blue'), cex=0.75, scales=list(y=list(tick.number=4, rot=90, relation="free", cex=0.5, alternating=T), x=list(cex=.6 ) ), xlab = "readsize in nucleotides", ylab = "${ylabel}", main="${title}" , par.strip.text = list(cex=0.75), as.table=TRUE, newpage = T, ...) combineLimits(update(useOuterStrips(bc, strip.left = strip.custom(par.strip.text = list(cex=0.5)) ), layout=c(n_samples,${rows_per_page})), margin.x=F, margin.y=1) } # per_gene_size=lapply(genes, function(x) subset(size, gene==x)) # no object in this script global = "no" #if $global.value == 'yes': global = "yes" #end if if (global=="no") { options(warn=-1) pdf(file="${size_PDF}", paper="special", height=11.69, width=8.2677*n_samples/4) plot_size_distribution(size, par.settings=par.settings.size) # removed , prepanel=smR.prepanel } else { pdf(file="${size_PDF}", paper="special", height=11.69, width=8.2677) bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample)), data = size, origin = 0, horizontal=FALSE, group=polarity, stack=TRUE, col=c('red', 'blue'), # par.settings=list(fontsize = list(text=8, points=8)), scales=list(y=list(tick.number=4, rot=90, relation="same"), cex=1), xlab = "readsize in nucleotides", ylab = "${ylabel}", main="${title}" , as.table=TRUE, newpage = T, aspect=0.5, strip = strip.custom(par.strip.text = list(cex = 1), which.given=1, bg="lightblue") ) bc } devname=dev.off() </configfile> </configfiles> <outputs> <data format="tabular" name="size_distribution_dataframe" label="Size_distribution_dataframe.tab"/> <data format="pdf" name="size_PDF" label="Size_distribution.pdf"/> </outputs> <help> **What it does** Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a histogram of read sizes, where by default for each "chromosome" a histogram of read sizes is drawn. Reads that map in sense are on the top (red), reads that map antisense are on the bottom (blue). .. class:: warningmark '''TIP''' The input data can be produced using the sRbowtie tool. ---- '''Example''' Query sequence:: For a SAM file as the following: 5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 produce a plot like this: ---- .. image:: static/images/size_histogram.png :height: 800 :width: 500 </help> <tests> <test> <param name="genomeSource" value="history" /> <param name="ownFile" value="transposons.fasta" ftype="fasta" /> <param name="series_0|input" value="sample1.srbowtie_out" ftype="tabular"/> <param name="series_0|norm" value="1" /> <param name="series_1|input" value="sample2.srbowtie_out" ftype="tabular"/> <param name="series_1|norm" value="1" /> <param name="series_2|input" value="sample3.srbowtie_out" ftype="tabular"/> <param name="series_2|norm" value="1" /> <param name="global" value="no" /> <param name="collapsestrands" value="no" /> <param name="minquery" value="18"/> <param name="maxquery" value="30"/> <param name="title" value="Size distribution"/> <param name="xlabel" value="Size in nucleotides"/> <param name="ylabel" value="Number of reads"/> <param name="rows_per_page" value="10"/> <output name="size_distribution_dataframe" ftype="tabular" file="Size_distribution_dataframe.tab" /> <output name="size_PDF" ftype="pdf" file="Size_distribution.pdf" /> </test> </tests> </tool>