Mercurial > repos > drosofff > msp_sr_readmap_and_size_histograms
diff readmap.xml @ 23:d6b93af0da55 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/msp_sr_readmap_and_size_histograms commit 89caea4594db1ae6d6bb9c651bc6019bb6dd3ce6-dirty
author | mvdbeek |
---|---|
date | Sun, 24 Apr 2016 09:23:44 -0400 |
parents | dbac07fc9186 |
children | bf7388df53cf |
line wrap: on
line diff
--- a/readmap.xml Thu Feb 04 08:29:18 2016 -0500 +++ b/readmap.xml Sun Apr 24 09:23:44 2016 -0400 @@ -1,239 +1,109 @@ -<tool id="Readmap" name="Generate readmap and histograms from alignment files" version="1.1.5"> - <description>from sRbowtie aligment</description> - <requirements> - <requirement type="package" version="0.12.7">bowtie</requirement> - <requirement type="package" version="0.7.7">pysam</requirement> - <requirement type="package" version="3.1.2">R</requirement> - <requirement type="package" version="2.14">biocbasics</requirement> - <requirement type="package" version="1.9">numpy</requirement> - </requirements> -<command interpreter="python"> - readmap.py - #if $refGenomeSource.genomeSource == "history": - --reference_fasta ## sys.argv[2] - $refGenomeSource.ownFile ## index source - #else: - #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] - --reference_bowtie_index - $reference - #end if - --rcode - $plotCode - --output_readmap - $readmap_dataframe - --output_size_distribution - $size_distribution_dataframe - --minquery - $minquery - --maxquery - $maxquery - --input - #for $i in $refGenomeSource.series - $i.input - #end for - --ext - #for $i in $refGenomeSource.series - $i.input.ext - #end for - --label - #for $i in $refGenomeSource.series - "$i.input.name" - #end for - --normalization_factor - #for $i in $refGenomeSource.series - $i.norm - #end for - #if $gff: - --gff - $gff - #end if - +<tool id="Readmap" name="Generate readmap and histograms from alignment files" version="1.2.0"> + <description>from sRbowtie aligment</description> + <requirements> + <requirement type="package" version="1.0.0">bowtie</requirement> + <requirement type="package" version="0.9.0">pysam</requirement> + <requirement type="package" version="1.9.3">numpy</requirement> + <requirement type="package" version="1.3.0">r-optparse</requirement> + <requirement type="package" version="0.6_26">r-latticeextra</requirement> + <requirement type="package" version="2.0.0">r-gridextra</requirement> + </requirements> + <command><![CDATA[ + python2 $__tool_directory__/readmap.py + #if $refGenomeSource.genomeSource == "history": + --reference_fasta + $refGenomeSource.ownFile ## index source + #else: + #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] + --reference_bowtie_index + $reference + #end if + --output_readmap + "$readmap_dataframe" + --output_size_distribution + "$size_distribution_dataframe" + --minquery $minquery + --maxquery $maxquery + --input + #for $i in $refGenomeSource.series + $i.input + #end for + --ext + #for $i in $refGenomeSource.series + $i.input.ext + #end for + --label + #for $i in $refGenomeSource.series + "$i.input.name" + #end for + --normalization_factor + #for $i in $refGenomeSource.series + $i.norm + #end for + #if $gff: + --gff + $gff + #end if + ; Rscript $__tool_directory__/plot_size_readmap.r + --readmap_tab "$readmap_dataframe" + --size_distribution_tab "$size_distribution_dataframe" + --readmap_pdf "$readmap_PDF" + --size_distribution_pdf "$size_PDF" + --combi_pdf "$combi_PDF" + --title "$title" + --xlabel "$xlabel" + --ylabel "$ylabel" + --yrange "$yrange" + --rows_per_page "$rows_per_page" + ]]> </command> - <inputs> - <conditional name="refGenomeSource"> - <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> - <option value="indexed">Use a built-in index</option> - <option value="history">Use one from the history</option> - </param> - <when value="indexed"> - <repeat name="series" title="Add alignment files"> - <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"> - <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> - </param> - <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> - </repeat> - </when> - <when value="history"> - <param name="ownFile" type="data" format="fasta" label="Select a fasta file, that served as the reference index for the alignments" /> - <repeat name="series" title="Add alignment files"> - <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"/> - <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> - </repeat> - </when> - </conditional> - <param name="gff" type="data" format="gff3" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> - <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> - <param name="minquery" type="integer" size="3" value="18" label="Min size of query small RNAs" help="'18' = 18 nucleotides"/> - <param name="maxquery" type="integer" size="3" value="28" label="Max size of query small RNAs" help="'28' = 28 nucleotides"/> - <param name="title" type="text" size="15" value= "Readmaps and size distributions" label="Main Titles"/> - <param name="xlabel" type="text" size="15" value="Coordinates/read size" label="x axis label"/> - <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> - <param name="yrange" type="integer" size="3" value="0" label="y axis range for readmaps. 0 means auto-scaling."/> - <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> - <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> - </param> - </inputs> - <configfiles> - <configfile name="plotCode"> - ## Setup R error handling to go to stderr - options( show.error.messages=F, - error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) - library(RColorBrewer) - library(lattice) - library(latticeExtra) - library(grid) - library(gridExtra) - - ## data frames implementation - - rm=read.delim("${readmap_dataframe}", header=T, row.names=NULL) - n_samples=length(unique(rm\$sample)) - genes=unique(levels(rm\$gene)) - per_gene_readmap=lapply(genes, function(x) subset(rm, gene==x)) ####### ? - n_genes=length(per_gene_readmap) - - size=read.delim("${size_distribution_dataframe}", header=T, row.names=NULL) - per_gene_size=lapply(genes, function(x) subset(size, gene==x)) ###### ? - - ## end of data frames implementation - - ## functions - - plot_readmap=function(df, ...) { - combineLimits(xyplot(count~coord|factor(sample, levels=unique(sample))+reorder(gene, count, function(x) -sum(abs(x))), - data=df, - type='h', - scales= list(relation="free", x=list(rot=0, cex=0.7, axs="i", tck=0.5), y=list(tick.number=4, rot=90, cex=0.7)), - xlab=NULL, main=NULL, ylab=NULL, - as.table=T, - origin = 0, - horizontal=FALSE, - group=polarity, - col=c("red","blue"), - par.strip.text = list(cex=0.7), - ...)) - } - - plot_size_distribution= function(df, ...) { - smR.prepanel=function(x,y,...){; yscale=c(-max(abs(y)), max(abs(y)));list(ylim=yscale);} - bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample))+gene, data = df, origin = 0, - horizontal=FALSE, - group=polarity, - stack=TRUE, - col=c('red', 'blue'), - cex=0.75, - scales=list(y=list(tick.number=4, rot=90, relation="free", cex=0.7), x=list(cex=0.7) ), - prepanel=smR.prepanel, - xlab = NULL, - ylab = NULL, - main = NULL, - as.table=TRUE, - newpage = T, - par.strip.text = list(cex=0.7), - ...) - combineLimits(bc) - } - - ## end of functions - - ## function parameters' - - par.settings.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-2.5), strip.background = list(col=c("lightblue","lightgreen")) ) - par.settings.size=list(layout.heights=list(top.padding=-1, bottom.padding=-2.5), strip.background = list(col=c("lightblue","lightgreen")) ) - par.settings.combination.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-3), strip.background=list(col=c("lightblue","lightgreen")) ) - par.settings.combination.size=list(layout.heights=list(top.padding=-2, bottom.padding=-0.5), strip.background=list(col=c("lightblue", "lightgreen")) ) - - ## end of function parameters' - - ## GRAPHS - - if (n_genes > 7) {page_height_simple = 11.69; page_height_combi=11.69; rows_per_page=${rows_per_page}; extrarow=0 } else { - rows_per_page= n_genes; page_height_simple = 2.5*n_genes; page_height_combi=page_height_simple*2; extrarow=0 } - ## rows_per_page= 8; page_height_simple = 11.69/7*n_genes; page_height_combi=11.69/9*(n_genes*2); extrarow=0 } - ## rows_per_page= n_genes; page_height_simple = 11.69/n_genes/4; page_height_combi=11.69/(n_genes*2); extrarow=1 } - if (n_samples > 4) {page_width = 8.2677*n_samples/4} else {page_width = 8.2677*n_samples/3} # to test - - pdf(file="${readmap_PDF}", paper="special", height=page_height_simple, width=page_width) - for (i in seq(1,n_genes,rows_per_page)) { - start=i - end=i+rows_per_page-1 - if (end>n_genes) {end=n_genes} - if (${yrange} == 0) { readmap_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.readmap)) } else { - readmap_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, ylim=c(-${yrange}, ${yrange}) , par.settings=par.settings.readmap)) } - args.list=c(readmap_plot.list, list(nrow=rows_per_page, ncol=1, - main=textGrob("Read Maps (nucleotide coordinates)", gp=gpar(cex=1), just="top"), - left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90) - #sub=textGrob("readmap coordinates", gp=gpar(cex=.75), just="bottom") - ) - ) - do.call(grid.arrange, args.list) - } - devname=dev.off() - - - pdf(file="${size_PDF}", paper="special", height=page_height_simple, width=page_width) - for (i in seq(1,n_genes,rows_per_page)) { - start=i - end=i+rows_per_page-1 - if (end>n_genes) {end=n_genes} - plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, par.settings=par.settings.size) ) - args.list=c(plot.list, list(nrow=rows_per_page, ncol=1, - main=textGrob("Size distributions (in nucleotides)", gp=gpar(cex=1), just="top"), - left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90) - #sub="readsize in nucleotides" - ) - ) - do.call(grid.arrange, args.list) - } - devname=dev.off() - - pdf(file="${combi_PDF}", paper="special", height=page_height_combi, width=page_width) - if (rows_per_page %% 2 != 0) { rows_per_page = rows_per_page + 1} - for (i in seq(1,n_genes,rows_per_page/2)) { - start=i - end=i+rows_per_page/2-1 - if (end>n_genes) {end=n_genes} - if (${yrange} == 0) {readmap_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.readmap)) } else { - readmap_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, ylim=c(-${yrange}, ${yrange}), par.settings=par.settings.readmap)) } - size_plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, strip=FALSE, par.settings=par.settings.combination.size)) - plot.list=rbind(readmap_plot.list, size_plot.list ) - args.list=c(plot.list, list(nrow=rows_per_page + extrarow, ncol=1, - main=textGrob("${title}", gp=gpar(cex=1), just="top"), - left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90), - sub=textGrob("${xlabel}", gp=gpar(cex=1), just="bottom") - ) - ) - do.call(grid.arrange, args.list) - } - devname=dev.off() - - - </configfile> - </configfiles> - - <outputs> - <data format="tabular" name="readmap_dataframe" label="Readmap dataframe"/> - <data format="tabular" name="size_distribution_dataframe" label="Size distribution dataframe"/> - <data format="pdf" name="readmap_PDF" label="Readmaps"/> - <data format="pdf" name="size_PDF" label="Size distribution"/> - <data format="pdf" name="combi_PDF" label="Size distribution and Readmaps"/> - </outputs> -<help> + <inputs> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <repeat name="series" title="Add alignment files"> + <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"> + <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> + </param> + <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> + </repeat> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" label="Select a fasta file, that served as the reference index for the alignments" /> + <repeat name="series" title="Add alignment files"> + <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"/> + <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> + </repeat> + </when> + </conditional> + <param name="gff" type="data" format="gff3" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> + <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> + <param name="minquery" type="integer" size="3" value="18" label="Min size of query small RNAs" help="'18' = 18 nucleotides"/> + <param name="maxquery" type="integer" size="3" value="28" label="Max size of query small RNAs" help="'28' = 28 nucleotides"/> + <param name="title" type="text" size="15" value= "Readmaps and size distributions" label="Main Titles"/> + <param name="xlabel" type="text" size="15" value="Coordinates/read size" label="x axis label"/> + <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> + <param name="yrange" type="integer" size="3" value="0" label="y axis range for readmaps. 0 means auto-scaling."/> + <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> + <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> + </param> + </inputs> + <outputs> + <data format="tabular" name="readmap_dataframe" label="Readmap dataframe"/> + <data format="tabular" name="size_distribution_dataframe" label="Size distribution dataframe"/> + <data format="pdf" name="readmap_PDF" label="Readmaps"/> + <data format="pdf" name="size_PDF" label="Size distribution"/> + <data format="pdf" name="combi_PDF" label="Size distribution and Readmaps"/> + </outputs> + <help> **What it does** -Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a "Readmap", -where by default for each "chromosome" the position of the read is recorded on the x-axis, and the y-axis indicates +Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a "Readmap", +where by default for each "chromosome" the position of the read is recorded on the x-axis, and the y-axis indicates the number of reads per position. Reads that map in sense are on the top, reads that map antisense are on the bottom. @@ -248,42 +118,42 @@ Query sequence:: For a SAM file as the following: - 5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 +5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 - 11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 +11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 - 2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 +2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 produce a plot like this: ---- -.. image:: static/images/readmap.png - :height: 800 - :width: 500 +.. image:: static/images/readmap.png +:height: 800 +:width: 500 -</help> - <tests> - <test> - <param name="genomeSource" value="history" /> - <param name="ownFile" value ="transposons.fasta" ftype="fasta" /> - <param name="series_0|input" value="sample1.srbowtie_out" ftype="tabular"/> - <param name="series_0|norm" value="1" /> - <param name="series_1|input" value="sample2.srbowtie_out" ftype="tabular"/> - <param name="series_1|norm" value="1" /> - <param name="series_2|input" value="sample3.srbowtie_out" ftype="tabular"/> - <param name="series_2|norm" value="1" /> - <param name="minquery" value="20" /> - <param name="maxquery" value="30" /> - <param name="title" value="Readmaps and size distributions" /> - <param name="xlabel" value="Coordinates/read size" /> - <param name="ylabel" value="Number of reads" /> - <param name="rows_per_page" value="8" /> - <output name="readmap_dataframe" ftype="tabular" file="Readmap_dataframe.tab" /> - <output name="size_distribution_dataframe" ftype="tabular" file="Size_distribution_dataframe.tab" /> - <output name="readmap_PDF" ftype="pdf" file="Readmaps.pdf" /> - <output name="size_PDF" ftype="pdf" file="Size_distribution.pdf" /> - <output name="combi_PDF" ftype="pdf" file="Size_distribution_and_Readmaps.pdf" /> - </test> - </tests> + </help> + <tests> + <test> + <param name="genomeSource" value="history" /> + <param name="ownFile" value ="transposons.fasta" ftype="fasta" /> + <param name="series_0|input" value="sample1.srbowtie_out" ftype="tabular"/> + <param name="series_0|norm" value="1" /> + <param name="series_1|input" value="sample2.srbowtie_out" ftype="tabular"/> + <param name="series_1|norm" value="1" /> + <param name="series_2|input" value="sample3.srbowtie_out" ftype="tabular"/> + <param name="series_2|norm" value="1" /> + <param name="minquery" value="20" /> + <param name="maxquery" value="30" /> + <param name="title" value="Readmaps and size distributions" /> + <param name="xlabel" value="Coordinates/read size" /> + <param name="ylabel" value="Number of reads" /> + <param name="rows_per_page" value="8" /> + <output name="readmap_dataframe" ftype="tabular" file="Readmap_dataframe.tab" /> + <output name="size_distribution_dataframe" ftype="tabular" file="Size_distribution_dataframe.tab" /> + <output name="readmap_PDF" ftype="pdf" file="Readmaps.pdf" /> + <output name="size_PDF" ftype="pdf" file="Size_distribution.pdf" /> + <output name="combi_PDF" ftype="pdf" file="Size_distribution_and_Readmaps.pdf" /> + </test> + </tests> </tool>