Mercurial > repos > drosofff > mississipi_gcc2
comparison size_histogram.xml @ 0:de6a6afc5a79 draft default tip
Uploaded
| author | drosofff |
|---|---|
| date | Tue, 24 Jun 2014 12:16:43 -0400 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| -1:000000000000 | 0:de6a6afc5a79 |
|---|---|
| 1 <tool id="Size_histogram" name="Generate size histograms from alignment files" version="0.9.0"> | |
| 2 <description>from sRbowtie aligment</description> | |
| 3 <requirements><requirement type='package'>bowtie-inspect</requirement></requirements> | |
| 4 <parallelism method="basic"></parallelism> | |
| 5 <command interpreter="python"> | |
| 6 size_histogram.py | |
| 7 #if $refGenomeSource.genomeSource == "history": | |
| 8 --reference_fasta ## sys.argv[2] | |
| 9 $refGenomeSource.ownFile ## index source | |
| 10 #else: | |
| 11 #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] | |
| 12 --reference_bowtie_index | |
| 13 $reference | |
| 14 #end if | |
| 15 --rcode | |
| 16 $plotCode | |
| 17 --output_size_distribution | |
| 18 $size_distribution_dataframe | |
| 19 --minquery | |
| 20 $minquery | |
| 21 --maxquery | |
| 22 $maxquery | |
| 23 --input | |
| 24 #for $i in $refGenomeSource.series | |
| 25 $i.input | |
| 26 #end for | |
| 27 --ext | |
| 28 #for $i in $refGenomeSource.series | |
| 29 $i.input.ext | |
| 30 #end for | |
| 31 --label | |
| 32 #for $i in $refGenomeSource.series | |
| 33 "$i.input.name" | |
| 34 #end for | |
| 35 --normalization_factor | |
| 36 #for $i in $refGenomeSource.series | |
| 37 $i.norm | |
| 38 #end for | |
| 39 #if $gff: | |
| 40 --gff | |
| 41 $gff | |
| 42 #end if | |
| 43 #if $global.value == 'yes': | |
| 44 --global_size | |
| 45 #end if | |
| 46 #if $collapsestrands.value == 'yes': | |
| 47 --collapse | |
| 48 #end if | |
| 49 | |
| 50 </command> | |
| 51 <inputs> | |
| 52 <conditional name="refGenomeSource"> | |
| 53 <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> | |
| 54 <option value="indexed">Use a built-in index</option> | |
| 55 <option value="history">Use one from the history</option> | |
| 56 </param> | |
| 57 <when value="indexed"> | |
| 58 <repeat name="series" title="Add alignment files"> | |
| 59 <param name="input" type="data" label="Select multiple alignments to parse"> | |
| 60 <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> | |
| 61 </param> | |
| 62 <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> | |
| 63 </repeat> | |
| 64 </when> | |
| 65 <when value="history"> | |
| 66 <repeat name="series" title="Add alignment files"> | |
| 67 <param name="input" type="data" label="Select multiple alignments to parse"/> | |
| 68 <param name="norm" type="integer" value="1" label="Indicate a normalization factor to compare multiple aligments"/> | |
| 69 </repeat> | |
| 70 </when> | |
| 71 </conditional> | |
| 72 <param name="gff" type="data" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> | |
| 73 <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> | |
| 74 <param name="global" type="select" label="Generate size distribution for each item, or generate a global alignment"> | |
| 75 <option value="no">for each item</option> | |
| 76 <option value="yes">global</option> | |
| 77 </param> | |
| 78 <param name="collapsestrands" type="select" label="Whether + and - reads should be collapsed or not"> | |
| 79 <option value="no">Do not collapse</option> | |
| 80 <option value="yes">Collapse + and - reads</option> | |
| 81 </param> | |
| 82 <param name="minquery" type="integer" size="3" value="18" label="Min size of reads to plot" help="'15' = 15 nucleotides"/> | |
| 83 <param name="maxquery" type="integer" size="3" value="28" label="Max size of reads to plot" help="'30' = 30 nucleotides"/> | |
| 84 <param name="title" type="text" size="15" value="Size distribution" label="Main Titles"/> | |
| 85 <param name="xlabel" type="text" size="15" value="Size in nucleotides" label="x axis label"/> | |
| 86 <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> | |
| 87 <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> | |
| 88 <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> | |
| 89 </param> | |
| 90 </inputs> | |
| 91 <configfiles> | |
| 92 <configfile name="plotCode"> | |
| 93 ## Setup R error handling to go to stderr | |
| 94 options( show.error.messages=F, | |
| 95 error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) | |
| 96 library(RColorBrewer) | |
| 97 library(lattice) | |
| 98 library(latticeExtra) | |
| 99 library(grid) | |
| 100 library(gridExtra) | |
| 101 ##cheetahtemplate data frame implementation | |
| 102 | |
| 103 size=read.delim("${size_distribution_dataframe}", header=T, row.names=NULL) | |
| 104 | |
| 105 n_samples=length(unique(size\$sample)) | |
| 106 genes=unique(levels(size\$gene)) | |
| 107 n_genes=length(genes) | |
| 108 | |
| 109 par.settings.size=list(layout.heights=list(top.padding=-1, bottom.padding=-3, strip = .75), fontsize = list(text=96/${rows_per_page}, points=8)) | |
| 110 smR.prepanel=function(x,y,...){; yscale=c(-max(abs(y)), max(abs(y)));list(ylim=yscale);} | |
| 111 | |
| 112 plot_size_distribution= function(df, ...) { | |
| 113 bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample))+gene, data = df, origin = 0, | |
| 114 horizontal=FALSE, | |
| 115 group=polarity, | |
| 116 stack=TRUE, | |
| 117 col=c('red', 'blue'), | |
| 118 strip = strip.custom(par.strip.text = list(cex = 0.5)), | |
| 119 cex=0.75, | |
| 120 scales=list(y=list(tick.number=4, rot=90, relation="free"), cex=0.75), | |
| 121 xlab = "readsize in nucleotides", | |
| 122 ylab = "${ylabel}", | |
| 123 main="${title}" , | |
| 124 as.table=TRUE, newpage = T, ...) | |
| 125 combineLimits(update(useOuterStrips(bc), layout=c(n_samples,${rows_per_page})), margin.x=F, margin.y=1) | |
| 126 } | |
| 127 | |
| 128 per_gene_size=lapply(genes, function(x) subset(size, gene==x)) | |
| 129 | |
| 130 global = "no" | |
| 131 #if $global.value == 'yes': | |
| 132 global = "yes" | |
| 133 #end if | |
| 134 | |
| 135 if (global=="no") { | |
| 136 options(warn=-1) | |
| 137 pdf(file="${size_PDF}", paper="special", height=11.69, width=8.2677*n_samples/4) | |
| 138 plot_size_distribution(size, par.settings=par.settings.size, prepanel=smR.prepanel) | |
| 139 } else { | |
| 140 pdf(file="${size_PDF}", paper="special", height=11.69, width=8.2677) | |
| 141 bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample)), data = size, origin = 0, | |
| 142 horizontal=FALSE, | |
| 143 group=polarity, | |
| 144 stack=TRUE, | |
| 145 col=c('red', 'blue'), | |
| 146 cex=0.75, | |
| 147 par.settings=list(fontsize = list(text=8, points=8)), | |
| 148 scales=list(y=list(tick.number=4, rot=90, relation="same"), cex=0.75), | |
| 149 xlab = "readsize in nucleotides", | |
| 150 ylab = "${ylabel}", | |
| 151 main="${title}" , as.table=TRUE, newpage = T, | |
| 152 aspect=0.5) | |
| 153 #layout=c(n_samples, ${rows_per_page})) | |
| 154 bc | |
| 155 } | |
| 156 devname=dev.off() | |
| 157 | |
| 158 </configfile> | |
| 159 </configfiles> | |
| 160 | |
| 161 <outputs> | |
| 162 <data format="tabular" name="size_distribution_dataframe" label="Size distributionn dataframe"/> | |
| 163 <data format="pdf" name="size_PDF" label="Size distribution"/> | |
| 164 </outputs> | |
| 165 <help> | |
| 166 | |
| 167 **What it does** | |
| 168 | |
| 169 Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a histogram of read sizes, | |
| 170 where by default for each "chromosome" a histogram of read sizes is drawn. | |
| 171 Reads that map in sense are on the top (red), reads that map antisense are on the bottom (blue). | |
| 172 | |
| 173 | |
| 174 .. class:: warningmark | |
| 175 | |
| 176 '''TIP''' The input data can be produced using the sRbowtie tool. | |
| 177 | |
| 178 ---- | |
| 179 | |
| 180 '''Example''' | |
| 181 | |
| 182 Query sequence:: | |
| 183 For a SAM file as the following: | |
| 184 | |
| 185 5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 | |
| 186 | |
| 187 11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 | |
| 188 | |
| 189 2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 | |
| 190 | |
| 191 produce a plot like this: | |
| 192 | |
| 193 ---- | |
| 194 | |
| 195 .. image:: static/images/size_histogram.png | |
| 196 :height: 800 | |
| 197 :width: 500 | |
| 198 | |
| 199 </help> | |
| 200 </tool> |
