# HG changeset patch # User dfornika # Date 1666651528 0 # Node ID 96fa1fed3a05d8bfc9579c0b950967dcc3dcbfbf # Parent feb574aa3b207791b287ca4edb0e3cb02488ac58 Deleted selected files diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/.shed.yml --- a/tbprofiler_json_to_tabular/.shed.yml Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,10 +0,0 @@ -categories: - - Sequence Analysis -description: 'Parse selected fields from tbprofiler json output to tabular format' -long_description: | - Parse selected fields from tbprofiler json output to tabular format -name: tbprofiler_json_to_tabular -owner: public-health-bioinformatics -remote_repository_url: https://github.com/public-health-bioinformatics/galaxy_tools/tree/master/tools/tbprofiler_json_to_tabular -homepage_url: https://github.com/public-health-bioinformatics/galaxy_tools/tree/master/tools/tbprofiler_json_to_tabular -type: unrestricted diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/tbprofiler_json_to_tabular.py --- a/tbprofiler_json_to_tabular/tbprofiler_json_to_tabular.py Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,137 +0,0 @@ -#!/usr/bin/env python - -import argparse -import csv -import json - - -def main(args): - - with open(args.input, 'r') as f: - report = json.load(f) - - qc_fieldnames = [ - 'pct_reads_mapped', - 'num_reads_mapped', - 'median_coverage', - ] - - with open(args.qc, 'w') as f: - writer = csv.DictWriter(f, fieldnames=qc_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) - writer.writeheader() - output = {k: report['qc'][k] for k in qc_fieldnames} - writer.writerow(output) - - gene_coverage_fieldnames = [ - 'locus_tag', - 'gene', - 'fraction', - 'cutoff', - ] - - with open(args.gene_coverage, 'w') as f: - writer = csv.DictWriter(f, fieldnames=gene_coverage_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) - writer.writeheader() - for row in report['qc']['gene_coverage']: - writer.writerow(row) - - missing_positions_fieldnames = [ - 'locus_tag', - 'gene', - 'position', - 'variants', - 'drugs' - ] - - with open(args.missing_positions, 'w') as f: - writer = csv.DictWriter(f, fieldnames=missing_positions_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) - writer.writeheader() - for row in report['qc']['missing_positions']: - writer.writerow(row) - - resistance_variants_fieldnames = [ - 'chrom', - 'genome_pos', - 'locus_tag', - 'feature_id', - 'gene', - 'type', - 'ref', - 'alt', - 'freq', - 'nucleotide_change', - 'protein_change', - 'change', - 'drugs', - ] - - with open(args.resistance_variants, 'w') as f: - writer = csv.DictWriter(f, fieldnames=resistance_variants_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) - writer.writeheader() - for row in report['dr_variants']: - row['drugs'] = ', '.join([drug['drug'] + ':' + drug['confers'] for drug in row['drugs']]) - output = {k: row[k] for k in resistance_variants_fieldnames} - writer.writerow(output) - - other_variants_fieldnames = [ - 'chrom', - 'genome_pos', - 'locus_tag', - 'feature_id', - 'gene', - 'type', - 'ref', - 'alt', - 'freq', - 'nucleotide_change', - 'protein_change', - 'change', - 'gene_associated_drugs', - ] - - with open(args.other_variants, 'w') as f: - writer = csv.DictWriter(f, fieldnames=other_variants_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) - writer.writeheader() - for row in report['other_variants']: - row['gene_associated_drugs'] = ', '.join(row['gene_associated_drugs']) - output = {k: row[k] for k in other_variants_fieldnames} - writer.writerow(output) - - analysis_metadata_fieldnames = [ - 'timestamp', - 'tbprofiler_version', - 'mapping_program', - 'variant_calling_program', - 'db_name', - 'db_commit', - 'db_date', - ] - - with open(args.analysis_metadata, 'w') as f: - writer = csv.DictWriter(f, fieldnames=analysis_metadata_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL) - writer.writeheader() - output = {} - output['timestamp'] = report['timestamp'] - output['tbprofiler_version'] = report['tbprofiler_version'] - output['db_name'] = report['db_version']['name'] - output['db_commit'] = report['db_version']['commit'] - output['db_date'] = report['db_version']['Date'] - for pipeline_entry in report['pipeline']: - if pipeline_entry['Analysis'] == "Mapping": - output['mapping_program'] = pipeline_entry['Program'] - elif pipeline_entry['Analysis'] == "Variant calling": - output['variant_calling_program'] = pipeline_entry['Program'] - - writer.writerow(output) - -if __name__ == '__main__': - parser = argparse.ArgumentParser() - parser.add_argument('input') - parser.add_argument('--qc') - parser.add_argument('--gene-coverage') - parser.add_argument('--missing-positions') - parser.add_argument('--resistance-variants') - parser.add_argument('--other-variants') - parser.add_argument('--analysis-metadata') - args = parser.parse_args() - main(args) diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/tbprofiler_json_to_tabular.xml --- a/tbprofiler_json_to_tabular/tbprofiler_json_to_tabular.xml Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,41 +0,0 @@ - - Convert tbprofiler json report to tabular - - - - - - - - - - - - - - - - - - - - - - - - - - - - - diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_analysis_metadata.tsv --- a/tbprofiler_json_to_tabular/test-data/test-01_analysis_metadata.tsv Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -timestamp tbprofiler_version mapping_program variant_calling_program db_name db_commit db_date -22-10-2022 01:09:50 4.1.1 bwa freebayes tbdb 7fc199d Tue Jan 25 17:21:48 2022 +0000 diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_gene_coverage.tsv --- a/tbprofiler_json_to_tabular/test-data/test-01_gene_coverage.tsv Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,43 +0,0 @@ -locus_tag gene fraction cutoff -Rv0005 gyrB 0.0 0 -Rv0006 gyrA 0.0 0 -Rv0407 fgd1 0.0 0 -Rv0486 mshA 0.0 0 -Rv0667 rpoB 0.0 0 -Rv0668 rpoC 0.0 0 -Rv0678 mmpR5 0.0 0 -Rv0682 rpsL 0.0 0 -Rv0701 rplC 0.0 0 -Rv1173 fbiC 0.0 0 -Rv1267c embR 0.0 0 -Rv1305 atpE 0.0 0 -EBG00000313325 rrs 0.0 0 -EBG00000313339 rrl 0.0 0 -Rv1483 fabG1 0.0 0 -Rv1484 inhA 0.0 0 -Rv1630 rpsA 0.0 0 -Rv1694 tlyA 0.0 0 -Rv1908c katG 0.0 0 -Rv2043c pncA 0.0 0 -Rv2245 kasA 0.0 0 -Rv2416c eis 0.0 0 -Rv2428 ahpC 0.0 0 -Rv2447c folC 0.0 0 -Rv2535c pepQ 0.0 0 -Rv2671 ribD 0.0 0 -Rv2754c thyX 0.0 0 -Rv2764c thyA 0.0 0 -Rv2780 ald 0.0 0 -Rv2983 fbiD 0.0 0 -Rv3261 fbiA 0.0 0 -Rv3262 fbiB 0.0 0 -Rv3423c alr 0.0 0 -Rv3547 ddn 0.0 0 -Rv3601c panD 0.0 0 -Rv3793 embC 0.0 0 -Rv3794 embA 0.0 0 -Rv3795 embB 0.0 0 -Rv3806c ubiA 0.0 0 -Rv3854c ethA 0.0 0 -Rv3855 ethR 0.0 0 -Rv3919c gid 0.0 0 diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_missing_positions.tsv --- a/tbprofiler_json_to_tabular/test-data/test-01_missing_positions.tsv Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -locus_tag gene position variants drugs diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_other_variants.tsv --- a/tbprofiler_json_to_tabular/test-data/test-01_other_variants.tsv Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,14 +0,0 @@ -chrom genome_pos locus_tag feature_id gene type ref alt freq nucleotide_change protein_change change gene_associated_drugs -Chromosome 7362 Rv0006 CCP42728 gyrA missense_variant G C 1.0 c.61G>C p.Glu21Gln p.Glu21Gln levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones -Chromosome 7585 Rv0006 CCP42728 gyrA missense_variant G C 1.0 c.284G>C p.Ser95Thr p.Ser95Thr levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones -Chromosome 7892 Rv0006 CCP42728 gyrA synonymous_variant G A 1.0 c.591G>A p.Leu197Leu c.591G>A levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones -Chromosome 9304 Rv0006 CCP42728 gyrA missense_variant G A 1.0 c.2003G>A p.Gly668Asp p.Gly668Asp levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones -Chromosome 766789 Rv0668 CCP43411 rpoC synonymous_variant G A 1.0 c.3420G>A p.Glu1140Glu c.3420G>A rifampicin -Chromosome 781395 Rv0682 CCP43425 rpsL upstream_gene_variant T C 1.0 c.-165T>C c.-165T>C streptomycin -Chromosome 1305494 Rv1173 CCP43929 fbiC frameshift_variant&stop_lost&splice_region_variant CGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT C 0.21739130434782608 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT p.Ala855fs c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT delamanid -Chromosome 1460976 Rv1305 CCP44062 atpE upstream_gene_variant C T 1.0 c.-69C>T c.-69C>T bedaquiline -Chromosome 1471659 EBG00000313325 EBG00000313325-1 rrs upstream_gene_variant C T 1.0 n.-187C>T n.-187C>T aminoglycosides, streptomycin, amikacin, capreomycin, kanamycin -Chromosome 1917972 Rv1694 CCP44459 tlyA synonymous_variant A G 1.0 c.33A>G p.Leu11Leu c.33A>G capreomycin -Chromosome 3073868 Rv2764c CCP45563 thyA missense_variant T C 1.0 c.604A>G p.Thr202Ala p.Thr202Ala para-aminosalicylic_acid -Chromosome 4242643 Rv3794 CCP46623 embA upstream_gene_variant C T 1.0 c.-590C>T c.-590C>T ethambutol -Chromosome 1305494 Rv1173 CCP43929 fbiC frameshift_variant&stop_lost&splice_region_variant C 1.0 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN p.Ala855fs c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN delamanid diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_qc.tsv --- a/tbprofiler_json_to_tabular/test-data/test-01_qc.tsv Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -pct_reads_mapped num_reads_mapped median_coverage -99.47 1731409 84 diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_resistance_variants.tsv --- a/tbprofiler_json_to_tabular/test-data/test-01_resistance_variants.tsv Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,3 +0,0 @@ -chrom genome_pos locus_tag feature_id gene type ref alt freq nucleotide_change protein_change change drugs -Chromosome 761155 Rv0667 CCP43410 rpoB missense_variant C T 1.0 c.1349C>T p.Ser450Leu p.Ser450Leu rifampicin:resistance -Chromosome 1674048 Rv1484 CCP44244 inhA upstream_gene_variant G A 1.0 c.-154G>A c.-154G>A isoniazid:resistance, ethionamide:resistance diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_tbprofiler.json --- a/tbprofiler_json_to_tabular/test-data/test-01_tbprofiler.json Mon Oct 24 22:44:56 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,635 +0,0 @@ -{ - "qc": { - "pct_reads_mapped": 99.47, - "num_reads_mapped": 1731409, - "median_coverage": 84, - "gene_coverage": [ - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv0005", - "gene": "gyrB" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv0006", - "gene": "gyrA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv0407", - "gene": "fgd1" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv0486", - "gene": "mshA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv0667", - "gene": "rpoB" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv0668", - "gene": "rpoC" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv0678", - "gene": "mmpR5" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv0682", - "gene": "rpsL" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv0701", - "gene": "rplC" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv1173", - "gene": "fbiC" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv1267c", - "gene": "embR" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv1305", - "gene": "atpE" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "EBG00000313325", - "gene": "rrs" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "EBG00000313339", - "gene": "rrl" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv1483", - "gene": "fabG1" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv1484", - "gene": "inhA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv1630", - "gene": "rpsA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv1694", - "gene": "tlyA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv1908c", - "gene": "katG" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2043c", - "gene": "pncA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2245", - "gene": "kasA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2416c", - "gene": "eis" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2428", - "gene": "ahpC" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2447c", - "gene": "folC" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2535c", - "gene": "pepQ" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2671", - "gene": "ribD" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2754c", - "gene": "thyX" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2764c", - "gene": "thyA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2780", - "gene": "ald" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv2983", - "gene": "fbiD" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3261", - "gene": "fbiA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3262", - "gene": "fbiB" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3423c", - "gene": "alr" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3547", - "gene": "ddn" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3601c", - "gene": "panD" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3793", - "gene": "embC" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3794", - "gene": "embA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3795", - "gene": "embB" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3806c", - "gene": "ubiA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3854c", - "gene": "ethA" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3855", - "gene": "ethR" - }, - { - "fraction": 0.0, - "cutoff": 0, - "locus_tag": "Rv3919c", - "gene": "gid" - } - ], - "missing_positions": [] - }, - "delly": "success", - "lineage": [ - { - "lin": "lineage4", - "family": "Euro-American", - "spoligotype": "LAM;T;S;X;H", - "rd": "None", - "frac": 1.0 - }, - { - "lin": "lineage4.5", - "family": "Euro-American", - "spoligotype": "H;T", - "rd": "RD122", - "frac": 1.0 - } - ], - "main_lin": "lineage4", - "sublin": "lineage4.5", - "dr_variants": [ - { - "chrom": "Chromosome", - "genome_pos": 761155, - "ref": "C", - "alt": "T", - "freq": 1.0, - "feature_id": "CCP43410", - "type": "missense_variant", - "nucleotide_change": "c.1349C>T", - "protein_change": "p.Ser450Leu", - "annotation": [ - { - "type": "resistance_association_confidence", - "drug": "rifampicin", - "confidence": "high" - } - ], - "alternate_consequences": [], - "change": "p.Ser450Leu", - "locus_tag": "Rv0667", - "gene": "rpoB", - "drugs": [ - { - "type": "drug", - "drug": "rifampicin", - "confers": "resistance", - "literature": "10.1128/AAC.01093-18" - } - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 1674048, - "ref": "G", - "alt": "A", - "freq": 1.0, - "feature_id": "CCP44244", - "type": "upstream_gene_variant", - "nucleotide_change": "c.-154G>A", - "protein_change": "", - "annotation": [], - "alternate_consequences": [], - "change": "c.-154G>A", - "locus_tag": "Rv1484", - "gene": "inhA", - "drugs": [ - { - "type": "drug", - "drug": "isoniazid", - "confers": "resistance", - "literature": "https://www.who.int/publications/i/item/9789240028173" - }, - { - "type": "drug", - "drug": "ethionamide", - "confers": "resistance", - "literature": "https://www.who.int/publications/i/item/9789240028173" - } - ] - } - ], - "other_variants": [ - { - "chrom": "Chromosome", - "genome_pos": 7362, - "ref": "G", - "alt": "C", - "freq": 1.0, - "feature_id": "CCP42728", - "type": "missense_variant", - "nucleotide_change": "c.61G>C", - "protein_change": "p.Glu21Gln", - "alternate_consequences": [], - "change": "p.Glu21Gln", - "locus_tag": "Rv0006", - "gene": "gyrA", - "gene_associated_drugs": [ - "levofloxacin", - "ciprofloxacin", - "ofloxacin", - "moxifloxacin", - "fluoroquinolones" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 7585, - "ref": "G", - "alt": "C", - "freq": 1.0, - "feature_id": "CCP42728", - "type": "missense_variant", - "nucleotide_change": "c.284G>C", - "protein_change": "p.Ser95Thr", - "annotation": [ - { - "type": "phylogenetic_mutation", - "lineage": "lineage4" - } - ], - "alternate_consequences": [], - "change": "p.Ser95Thr", - "locus_tag": "Rv0006", - "gene": "gyrA", - "gene_associated_drugs": [ - "levofloxacin", - "ciprofloxacin", - "ofloxacin", - "moxifloxacin", - "fluoroquinolones" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 7892, - "ref": "G", - "alt": "A", - "freq": 1.0, - "feature_id": "CCP42728", - "type": "synonymous_variant", - "nucleotide_change": "c.591G>A", - "protein_change": "p.Leu197Leu", - "alternate_consequences": [], - "change": "c.591G>A", - "locus_tag": "Rv0006", - "gene": "gyrA", - "gene_associated_drugs": [ - "levofloxacin", - "ciprofloxacin", - "ofloxacin", - "moxifloxacin", - "fluoroquinolones" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 9304, - "ref": "G", - "alt": "A", - "freq": 1.0, - "feature_id": "CCP42728", - "type": "missense_variant", - "nucleotide_change": "c.2003G>A", - "protein_change": "p.Gly668Asp", - "alternate_consequences": [], - "change": "p.Gly668Asp", - "locus_tag": "Rv0006", - "gene": "gyrA", - "gene_associated_drugs": [ - "levofloxacin", - "ciprofloxacin", - "ofloxacin", - "moxifloxacin", - "fluoroquinolones" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 766789, - "ref": "G", - "alt": "A", - "freq": 1.0, - "feature_id": "CCP43411", - "type": "synonymous_variant", - "nucleotide_change": "c.3420G>A", - "protein_change": "p.Glu1140Glu", - "alternate_consequences": [], - "change": "c.3420G>A", - "locus_tag": "Rv0668", - "gene": "rpoC", - "gene_associated_drugs": [ - "rifampicin" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 781395, - "ref": "T", - "alt": "C", - "freq": 1.0, - "feature_id": "CCP43425", - "type": "upstream_gene_variant", - "nucleotide_change": "c.-165T>C", - "protein_change": "", - "alternate_consequences": [], - "change": "c.-165T>C", - "locus_tag": "Rv0682", - "gene": "rpsL", - "gene_associated_drugs": [ - "streptomycin" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 1305494, - "ref": "CGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT", - "alt": "C", - "freq": 0.21739130434782608, - "feature_id": "CCP43929", - "type": "frameshift_variant&stop_lost&splice_region_variant", - "nucleotide_change": "c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT", - "protein_change": "p.Ala855fs", - "alternate_consequences": [], - "change": "c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT", - "locus_tag": "Rv1173", - "gene": "fbiC", - "gene_associated_drugs": [ - "delamanid" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 1460976, - "ref": "C", - "alt": "T", - "freq": 1.0, - "feature_id": "CCP44062", - "type": "upstream_gene_variant", - "nucleotide_change": "c.-69C>T", - "protein_change": "", - "alternate_consequences": [], - "change": "c.-69C>T", - "locus_tag": "Rv1305", - "gene": "atpE", - "gene_associated_drugs": [ - "bedaquiline" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 1471659, - "ref": "C", - "alt": "T", - "freq": 1.0, - "feature_id": "EBG00000313325-1", - "type": "upstream_gene_variant", - "nucleotide_change": "n.-187C>T", - "protein_change": "", - "alternate_consequences": [], - "change": "n.-187C>T", - "locus_tag": "EBG00000313325", - "gene": "rrs", - "gene_associated_drugs": [ - "aminoglycosides", - "streptomycin", - "amikacin", - "capreomycin", - "kanamycin" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 1917972, - "ref": "A", - "alt": "G", - "freq": 1.0, - "feature_id": "CCP44459", - "type": "synonymous_variant", - "nucleotide_change": "c.33A>G", - "protein_change": "p.Leu11Leu", - "alternate_consequences": [], - "change": "c.33A>G", - "locus_tag": "Rv1694", - "gene": "tlyA", - "gene_associated_drugs": [ - "capreomycin" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 3073868, - "ref": "T", - "alt": "C", - "freq": 1.0, - "feature_id": "CCP45563", - "type": "missense_variant", - "nucleotide_change": "c.604A>G", - "protein_change": "p.Thr202Ala", - "alternate_consequences": [], - "change": "p.Thr202Ala", - "locus_tag": "Rv2764c", - "gene": "thyA", - "gene_associated_drugs": [ - "para-aminosalicylic_acid" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 4242643, - "ref": "C", - "alt": "T", - "freq": 1.0, - "feature_id": "CCP46623", - "type": "upstream_gene_variant", - "nucleotide_change": "c.-590C>T", - "protein_change": "", - "alternate_consequences": [ - { - "gene_name": "embC", - "gene_id": "Rv3793", - "feature_id": "CCP46622", - "type": "synonymous_variant", - "nucleotide_change": "c.2781C>T", - "protein_change": "p.Arg927Arg" - } - ], - "change": "c.-590C>T", - "locus_tag": "Rv3794", - "gene": "embA", - "gene_associated_drugs": [ - "ethambutol" - ] - }, - { - "chrom": "Chromosome", - "genome_pos": 1305494, - "ref": "C", - "alt": "", - "freq": 1.0, - "feature_id": "CCP43929", - "type": "frameshift_variant&stop_lost&splice_region_variant", - "nucleotide_change": "c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN", - "protein_change": "p.Ala855fs", - "alternate_consequences": [], - "change": "c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN", - "locus_tag": "Rv1173", - "gene": "fbiC", - "gene_associated_drugs": [ - "delamanid" - ] - } - ], - "drtype": "MDR-TB", - "db_version": { - "name": "tbdb", - "commit": "7fc199d", - "Merge": "bad550a 277d053", - "Author": "Jody Phelan ", - "Date": "Tue Jan 25 17:21:48 2022 +0000" - }, - "id": "tbprofiler", - "tbprofiler_version": "4.1.1", - "pipeline": [ - { - "Analysis": "Mapping", - "Program": "bwa" - }, - { - "Analysis": "Variant calling", - "Program": "freebayes" - } - ], - "timestamp": "22-10-2022 01:09:50" -}