# HG changeset patch
# User dfornika
# Date 1666651528 0
# Node ID 96fa1fed3a05d8bfc9579c0b950967dcc3dcbfbf
# Parent feb574aa3b207791b287ca4edb0e3cb02488ac58
Deleted selected files
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/.shed.yml
--- a/tbprofiler_json_to_tabular/.shed.yml Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,10 +0,0 @@
-categories:
- - Sequence Analysis
-description: 'Parse selected fields from tbprofiler json output to tabular format'
-long_description: |
- Parse selected fields from tbprofiler json output to tabular format
-name: tbprofiler_json_to_tabular
-owner: public-health-bioinformatics
-remote_repository_url: https://github.com/public-health-bioinformatics/galaxy_tools/tree/master/tools/tbprofiler_json_to_tabular
-homepage_url: https://github.com/public-health-bioinformatics/galaxy_tools/tree/master/tools/tbprofiler_json_to_tabular
-type: unrestricted
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/tbprofiler_json_to_tabular.py
--- a/tbprofiler_json_to_tabular/tbprofiler_json_to_tabular.py Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,137 +0,0 @@
-#!/usr/bin/env python
-
-import argparse
-import csv
-import json
-
-
-def main(args):
-
- with open(args.input, 'r') as f:
- report = json.load(f)
-
- qc_fieldnames = [
- 'pct_reads_mapped',
- 'num_reads_mapped',
- 'median_coverage',
- ]
-
- with open(args.qc, 'w') as f:
- writer = csv.DictWriter(f, fieldnames=qc_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
- writer.writeheader()
- output = {k: report['qc'][k] for k in qc_fieldnames}
- writer.writerow(output)
-
- gene_coverage_fieldnames = [
- 'locus_tag',
- 'gene',
- 'fraction',
- 'cutoff',
- ]
-
- with open(args.gene_coverage, 'w') as f:
- writer = csv.DictWriter(f, fieldnames=gene_coverage_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
- writer.writeheader()
- for row in report['qc']['gene_coverage']:
- writer.writerow(row)
-
- missing_positions_fieldnames = [
- 'locus_tag',
- 'gene',
- 'position',
- 'variants',
- 'drugs'
- ]
-
- with open(args.missing_positions, 'w') as f:
- writer = csv.DictWriter(f, fieldnames=missing_positions_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
- writer.writeheader()
- for row in report['qc']['missing_positions']:
- writer.writerow(row)
-
- resistance_variants_fieldnames = [
- 'chrom',
- 'genome_pos',
- 'locus_tag',
- 'feature_id',
- 'gene',
- 'type',
- 'ref',
- 'alt',
- 'freq',
- 'nucleotide_change',
- 'protein_change',
- 'change',
- 'drugs',
- ]
-
- with open(args.resistance_variants, 'w') as f:
- writer = csv.DictWriter(f, fieldnames=resistance_variants_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
- writer.writeheader()
- for row in report['dr_variants']:
- row['drugs'] = ', '.join([drug['drug'] + ':' + drug['confers'] for drug in row['drugs']])
- output = {k: row[k] for k in resistance_variants_fieldnames}
- writer.writerow(output)
-
- other_variants_fieldnames = [
- 'chrom',
- 'genome_pos',
- 'locus_tag',
- 'feature_id',
- 'gene',
- 'type',
- 'ref',
- 'alt',
- 'freq',
- 'nucleotide_change',
- 'protein_change',
- 'change',
- 'gene_associated_drugs',
- ]
-
- with open(args.other_variants, 'w') as f:
- writer = csv.DictWriter(f, fieldnames=other_variants_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
- writer.writeheader()
- for row in report['other_variants']:
- row['gene_associated_drugs'] = ', '.join(row['gene_associated_drugs'])
- output = {k: row[k] for k in other_variants_fieldnames}
- writer.writerow(output)
-
- analysis_metadata_fieldnames = [
- 'timestamp',
- 'tbprofiler_version',
- 'mapping_program',
- 'variant_calling_program',
- 'db_name',
- 'db_commit',
- 'db_date',
- ]
-
- with open(args.analysis_metadata, 'w') as f:
- writer = csv.DictWriter(f, fieldnames=analysis_metadata_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
- writer.writeheader()
- output = {}
- output['timestamp'] = report['timestamp']
- output['tbprofiler_version'] = report['tbprofiler_version']
- output['db_name'] = report['db_version']['name']
- output['db_commit'] = report['db_version']['commit']
- output['db_date'] = report['db_version']['Date']
- for pipeline_entry in report['pipeline']:
- if pipeline_entry['Analysis'] == "Mapping":
- output['mapping_program'] = pipeline_entry['Program']
- elif pipeline_entry['Analysis'] == "Variant calling":
- output['variant_calling_program'] = pipeline_entry['Program']
-
- writer.writerow(output)
-
-if __name__ == '__main__':
- parser = argparse.ArgumentParser()
- parser.add_argument('input')
- parser.add_argument('--qc')
- parser.add_argument('--gene-coverage')
- parser.add_argument('--missing-positions')
- parser.add_argument('--resistance-variants')
- parser.add_argument('--other-variants')
- parser.add_argument('--analysis-metadata')
- args = parser.parse_args()
- main(args)
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/tbprofiler_json_to_tabular.xml
--- a/tbprofiler_json_to_tabular/tbprofiler_json_to_tabular.xml Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,41 +0,0 @@
-
- Convert tbprofiler json report to tabular
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_analysis_metadata.tsv
--- a/tbprofiler_json_to_tabular/test-data/test-01_analysis_metadata.tsv Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-timestamp tbprofiler_version mapping_program variant_calling_program db_name db_commit db_date
-22-10-2022 01:09:50 4.1.1 bwa freebayes tbdb 7fc199d Tue Jan 25 17:21:48 2022 +0000
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_gene_coverage.tsv
--- a/tbprofiler_json_to_tabular/test-data/test-01_gene_coverage.tsv Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,43 +0,0 @@
-locus_tag gene fraction cutoff
-Rv0005 gyrB 0.0 0
-Rv0006 gyrA 0.0 0
-Rv0407 fgd1 0.0 0
-Rv0486 mshA 0.0 0
-Rv0667 rpoB 0.0 0
-Rv0668 rpoC 0.0 0
-Rv0678 mmpR5 0.0 0
-Rv0682 rpsL 0.0 0
-Rv0701 rplC 0.0 0
-Rv1173 fbiC 0.0 0
-Rv1267c embR 0.0 0
-Rv1305 atpE 0.0 0
-EBG00000313325 rrs 0.0 0
-EBG00000313339 rrl 0.0 0
-Rv1483 fabG1 0.0 0
-Rv1484 inhA 0.0 0
-Rv1630 rpsA 0.0 0
-Rv1694 tlyA 0.0 0
-Rv1908c katG 0.0 0
-Rv2043c pncA 0.0 0
-Rv2245 kasA 0.0 0
-Rv2416c eis 0.0 0
-Rv2428 ahpC 0.0 0
-Rv2447c folC 0.0 0
-Rv2535c pepQ 0.0 0
-Rv2671 ribD 0.0 0
-Rv2754c thyX 0.0 0
-Rv2764c thyA 0.0 0
-Rv2780 ald 0.0 0
-Rv2983 fbiD 0.0 0
-Rv3261 fbiA 0.0 0
-Rv3262 fbiB 0.0 0
-Rv3423c alr 0.0 0
-Rv3547 ddn 0.0 0
-Rv3601c panD 0.0 0
-Rv3793 embC 0.0 0
-Rv3794 embA 0.0 0
-Rv3795 embB 0.0 0
-Rv3806c ubiA 0.0 0
-Rv3854c ethA 0.0 0
-Rv3855 ethR 0.0 0
-Rv3919c gid 0.0 0
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_missing_positions.tsv
--- a/tbprofiler_json_to_tabular/test-data/test-01_missing_positions.tsv Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-locus_tag gene position variants drugs
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_other_variants.tsv
--- a/tbprofiler_json_to_tabular/test-data/test-01_other_variants.tsv Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,14 +0,0 @@
-chrom genome_pos locus_tag feature_id gene type ref alt freq nucleotide_change protein_change change gene_associated_drugs
-Chromosome 7362 Rv0006 CCP42728 gyrA missense_variant G C 1.0 c.61G>C p.Glu21Gln p.Glu21Gln levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones
-Chromosome 7585 Rv0006 CCP42728 gyrA missense_variant G C 1.0 c.284G>C p.Ser95Thr p.Ser95Thr levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones
-Chromosome 7892 Rv0006 CCP42728 gyrA synonymous_variant G A 1.0 c.591G>A p.Leu197Leu c.591G>A levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones
-Chromosome 9304 Rv0006 CCP42728 gyrA missense_variant G A 1.0 c.2003G>A p.Gly668Asp p.Gly668Asp levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones
-Chromosome 766789 Rv0668 CCP43411 rpoC synonymous_variant G A 1.0 c.3420G>A p.Glu1140Glu c.3420G>A rifampicin
-Chromosome 781395 Rv0682 CCP43425 rpsL upstream_gene_variant T C 1.0 c.-165T>C c.-165T>C streptomycin
-Chromosome 1305494 Rv1173 CCP43929 fbiC frameshift_variant&stop_lost&splice_region_variant CGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT C 0.21739130434782608 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT p.Ala855fs c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT delamanid
-Chromosome 1460976 Rv1305 CCP44062 atpE upstream_gene_variant C T 1.0 c.-69C>T c.-69C>T bedaquiline
-Chromosome 1471659 EBG00000313325 EBG00000313325-1 rrs upstream_gene_variant C T 1.0 n.-187C>T n.-187C>T aminoglycosides, streptomycin, amikacin, capreomycin, kanamycin
-Chromosome 1917972 Rv1694 CCP44459 tlyA synonymous_variant A G 1.0 c.33A>G p.Leu11Leu c.33A>G capreomycin
-Chromosome 3073868 Rv2764c CCP45563 thyA missense_variant T C 1.0 c.604A>G p.Thr202Ala p.Thr202Ala para-aminosalicylic_acid
-Chromosome 4242643 Rv3794 CCP46623 embA upstream_gene_variant C T 1.0 c.-590C>T c.-590C>T ethambutol
-Chromosome 1305494 Rv1173 CCP43929 fbiC frameshift_variant&stop_lost&splice_region_variant C 1.0 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN p.Ala855fs c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN delamanid
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_qc.tsv
--- a/tbprofiler_json_to_tabular/test-data/test-01_qc.tsv Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-pct_reads_mapped num_reads_mapped median_coverage
-99.47 1731409 84
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_resistance_variants.tsv
--- a/tbprofiler_json_to_tabular/test-data/test-01_resistance_variants.tsv Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,3 +0,0 @@
-chrom genome_pos locus_tag feature_id gene type ref alt freq nucleotide_change protein_change change drugs
-Chromosome 761155 Rv0667 CCP43410 rpoB missense_variant C T 1.0 c.1349C>T p.Ser450Leu p.Ser450Leu rifampicin:resistance
-Chromosome 1674048 Rv1484 CCP44244 inhA upstream_gene_variant G A 1.0 c.-154G>A c.-154G>A isoniazid:resistance, ethionamide:resistance
diff -r feb574aa3b20 -r 96fa1fed3a05 tbprofiler_json_to_tabular/test-data/test-01_tbprofiler.json
--- a/tbprofiler_json_to_tabular/test-data/test-01_tbprofiler.json Mon Oct 24 22:44:56 2022 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,635 +0,0 @@
-{
- "qc": {
- "pct_reads_mapped": 99.47,
- "num_reads_mapped": 1731409,
- "median_coverage": 84,
- "gene_coverage": [
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv0005",
- "gene": "gyrB"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv0006",
- "gene": "gyrA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv0407",
- "gene": "fgd1"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv0486",
- "gene": "mshA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv0667",
- "gene": "rpoB"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv0668",
- "gene": "rpoC"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv0678",
- "gene": "mmpR5"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv0682",
- "gene": "rpsL"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv0701",
- "gene": "rplC"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv1173",
- "gene": "fbiC"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv1267c",
- "gene": "embR"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv1305",
- "gene": "atpE"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "EBG00000313325",
- "gene": "rrs"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "EBG00000313339",
- "gene": "rrl"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv1483",
- "gene": "fabG1"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv1484",
- "gene": "inhA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv1630",
- "gene": "rpsA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv1694",
- "gene": "tlyA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv1908c",
- "gene": "katG"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2043c",
- "gene": "pncA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2245",
- "gene": "kasA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2416c",
- "gene": "eis"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2428",
- "gene": "ahpC"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2447c",
- "gene": "folC"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2535c",
- "gene": "pepQ"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2671",
- "gene": "ribD"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2754c",
- "gene": "thyX"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2764c",
- "gene": "thyA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2780",
- "gene": "ald"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv2983",
- "gene": "fbiD"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3261",
- "gene": "fbiA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3262",
- "gene": "fbiB"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3423c",
- "gene": "alr"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3547",
- "gene": "ddn"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3601c",
- "gene": "panD"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3793",
- "gene": "embC"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3794",
- "gene": "embA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3795",
- "gene": "embB"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3806c",
- "gene": "ubiA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3854c",
- "gene": "ethA"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3855",
- "gene": "ethR"
- },
- {
- "fraction": 0.0,
- "cutoff": 0,
- "locus_tag": "Rv3919c",
- "gene": "gid"
- }
- ],
- "missing_positions": []
- },
- "delly": "success",
- "lineage": [
- {
- "lin": "lineage4",
- "family": "Euro-American",
- "spoligotype": "LAM;T;S;X;H",
- "rd": "None",
- "frac": 1.0
- },
- {
- "lin": "lineage4.5",
- "family": "Euro-American",
- "spoligotype": "H;T",
- "rd": "RD122",
- "frac": 1.0
- }
- ],
- "main_lin": "lineage4",
- "sublin": "lineage4.5",
- "dr_variants": [
- {
- "chrom": "Chromosome",
- "genome_pos": 761155,
- "ref": "C",
- "alt": "T",
- "freq": 1.0,
- "feature_id": "CCP43410",
- "type": "missense_variant",
- "nucleotide_change": "c.1349C>T",
- "protein_change": "p.Ser450Leu",
- "annotation": [
- {
- "type": "resistance_association_confidence",
- "drug": "rifampicin",
- "confidence": "high"
- }
- ],
- "alternate_consequences": [],
- "change": "p.Ser450Leu",
- "locus_tag": "Rv0667",
- "gene": "rpoB",
- "drugs": [
- {
- "type": "drug",
- "drug": "rifampicin",
- "confers": "resistance",
- "literature": "10.1128/AAC.01093-18"
- }
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 1674048,
- "ref": "G",
- "alt": "A",
- "freq": 1.0,
- "feature_id": "CCP44244",
- "type": "upstream_gene_variant",
- "nucleotide_change": "c.-154G>A",
- "protein_change": "",
- "annotation": [],
- "alternate_consequences": [],
- "change": "c.-154G>A",
- "locus_tag": "Rv1484",
- "gene": "inhA",
- "drugs": [
- {
- "type": "drug",
- "drug": "isoniazid",
- "confers": "resistance",
- "literature": "https://www.who.int/publications/i/item/9789240028173"
- },
- {
- "type": "drug",
- "drug": "ethionamide",
- "confers": "resistance",
- "literature": "https://www.who.int/publications/i/item/9789240028173"
- }
- ]
- }
- ],
- "other_variants": [
- {
- "chrom": "Chromosome",
- "genome_pos": 7362,
- "ref": "G",
- "alt": "C",
- "freq": 1.0,
- "feature_id": "CCP42728",
- "type": "missense_variant",
- "nucleotide_change": "c.61G>C",
- "protein_change": "p.Glu21Gln",
- "alternate_consequences": [],
- "change": "p.Glu21Gln",
- "locus_tag": "Rv0006",
- "gene": "gyrA",
- "gene_associated_drugs": [
- "levofloxacin",
- "ciprofloxacin",
- "ofloxacin",
- "moxifloxacin",
- "fluoroquinolones"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 7585,
- "ref": "G",
- "alt": "C",
- "freq": 1.0,
- "feature_id": "CCP42728",
- "type": "missense_variant",
- "nucleotide_change": "c.284G>C",
- "protein_change": "p.Ser95Thr",
- "annotation": [
- {
- "type": "phylogenetic_mutation",
- "lineage": "lineage4"
- }
- ],
- "alternate_consequences": [],
- "change": "p.Ser95Thr",
- "locus_tag": "Rv0006",
- "gene": "gyrA",
- "gene_associated_drugs": [
- "levofloxacin",
- "ciprofloxacin",
- "ofloxacin",
- "moxifloxacin",
- "fluoroquinolones"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 7892,
- "ref": "G",
- "alt": "A",
- "freq": 1.0,
- "feature_id": "CCP42728",
- "type": "synonymous_variant",
- "nucleotide_change": "c.591G>A",
- "protein_change": "p.Leu197Leu",
- "alternate_consequences": [],
- "change": "c.591G>A",
- "locus_tag": "Rv0006",
- "gene": "gyrA",
- "gene_associated_drugs": [
- "levofloxacin",
- "ciprofloxacin",
- "ofloxacin",
- "moxifloxacin",
- "fluoroquinolones"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 9304,
- "ref": "G",
- "alt": "A",
- "freq": 1.0,
- "feature_id": "CCP42728",
- "type": "missense_variant",
- "nucleotide_change": "c.2003G>A",
- "protein_change": "p.Gly668Asp",
- "alternate_consequences": [],
- "change": "p.Gly668Asp",
- "locus_tag": "Rv0006",
- "gene": "gyrA",
- "gene_associated_drugs": [
- "levofloxacin",
- "ciprofloxacin",
- "ofloxacin",
- "moxifloxacin",
- "fluoroquinolones"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 766789,
- "ref": "G",
- "alt": "A",
- "freq": 1.0,
- "feature_id": "CCP43411",
- "type": "synonymous_variant",
- "nucleotide_change": "c.3420G>A",
- "protein_change": "p.Glu1140Glu",
- "alternate_consequences": [],
- "change": "c.3420G>A",
- "locus_tag": "Rv0668",
- "gene": "rpoC",
- "gene_associated_drugs": [
- "rifampicin"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 781395,
- "ref": "T",
- "alt": "C",
- "freq": 1.0,
- "feature_id": "CCP43425",
- "type": "upstream_gene_variant",
- "nucleotide_change": "c.-165T>C",
- "protein_change": "",
- "alternate_consequences": [],
- "change": "c.-165T>C",
- "locus_tag": "Rv0682",
- "gene": "rpsL",
- "gene_associated_drugs": [
- "streptomycin"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 1305494,
- "ref": "CGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT",
- "alt": "C",
- "freq": 0.21739130434782608,
- "feature_id": "CCP43929",
- "type": "frameshift_variant&stop_lost&splice_region_variant",
- "nucleotide_change": "c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT",
- "protein_change": "p.Ala855fs",
- "alternate_consequences": [],
- "change": "c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT",
- "locus_tag": "Rv1173",
- "gene": "fbiC",
- "gene_associated_drugs": [
- "delamanid"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 1460976,
- "ref": "C",
- "alt": "T",
- "freq": 1.0,
- "feature_id": "CCP44062",
- "type": "upstream_gene_variant",
- "nucleotide_change": "c.-69C>T",
- "protein_change": "",
- "alternate_consequences": [],
- "change": "c.-69C>T",
- "locus_tag": "Rv1305",
- "gene": "atpE",
- "gene_associated_drugs": [
- "bedaquiline"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 1471659,
- "ref": "C",
- "alt": "T",
- "freq": 1.0,
- "feature_id": "EBG00000313325-1",
- "type": "upstream_gene_variant",
- "nucleotide_change": "n.-187C>T",
- "protein_change": "",
- "alternate_consequences": [],
- "change": "n.-187C>T",
- "locus_tag": "EBG00000313325",
- "gene": "rrs",
- "gene_associated_drugs": [
- "aminoglycosides",
- "streptomycin",
- "amikacin",
- "capreomycin",
- "kanamycin"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 1917972,
- "ref": "A",
- "alt": "G",
- "freq": 1.0,
- "feature_id": "CCP44459",
- "type": "synonymous_variant",
- "nucleotide_change": "c.33A>G",
- "protein_change": "p.Leu11Leu",
- "alternate_consequences": [],
- "change": "c.33A>G",
- "locus_tag": "Rv1694",
- "gene": "tlyA",
- "gene_associated_drugs": [
- "capreomycin"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 3073868,
- "ref": "T",
- "alt": "C",
- "freq": 1.0,
- "feature_id": "CCP45563",
- "type": "missense_variant",
- "nucleotide_change": "c.604A>G",
- "protein_change": "p.Thr202Ala",
- "alternate_consequences": [],
- "change": "p.Thr202Ala",
- "locus_tag": "Rv2764c",
- "gene": "thyA",
- "gene_associated_drugs": [
- "para-aminosalicylic_acid"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 4242643,
- "ref": "C",
- "alt": "T",
- "freq": 1.0,
- "feature_id": "CCP46623",
- "type": "upstream_gene_variant",
- "nucleotide_change": "c.-590C>T",
- "protein_change": "",
- "alternate_consequences": [
- {
- "gene_name": "embC",
- "gene_id": "Rv3793",
- "feature_id": "CCP46622",
- "type": "synonymous_variant",
- "nucleotide_change": "c.2781C>T",
- "protein_change": "p.Arg927Arg"
- }
- ],
- "change": "c.-590C>T",
- "locus_tag": "Rv3794",
- "gene": "embA",
- "gene_associated_drugs": [
- "ethambutol"
- ]
- },
- {
- "chrom": "Chromosome",
- "genome_pos": 1305494,
- "ref": "C",
- "alt": "",
- "freq": 1.0,
- "feature_id": "CCP43929",
- "type": "frameshift_variant&stop_lost&splice_region_variant",
- "nucleotide_change": "c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN",
- "protein_change": "p.Ala855fs",
- "alternate_consequences": [],
- "change": "c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN",
- "locus_tag": "Rv1173",
- "gene": "fbiC",
- "gene_associated_drugs": [
- "delamanid"
- ]
- }
- ],
- "drtype": "MDR-TB",
- "db_version": {
- "name": "tbdb",
- "commit": "7fc199d",
- "Merge": "bad550a 277d053",
- "Author": "Jody Phelan ",
- "Date": "Tue Jan 25 17:21:48 2022 +0000"
- },
- "id": "tbprofiler",
- "tbprofiler_version": "4.1.1",
- "pipeline": [
- {
- "Analysis": "Mapping",
- "Program": "bwa"
- },
- {
- "Analysis": "Variant calling",
- "Program": "freebayes"
- }
- ],
- "timestamp": "22-10-2022 01:09:50"
-}