Mercurial > repos > devteam > fastx_trimmer
changeset 3:9081fe62bd56 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
| author | iuc | 
|---|---|
| date | Tue, 08 May 2018 12:53:09 -0400 | 
| parents | 97f0b63ae7cf | 
| children | 748363ac106b | 
| files | fastx_trimmer.xml macros.xml tool_dependencies.xml | 
| diffstat | 3 files changed, 73 insertions(+), 32 deletions(-) [+] | 
line wrap: on
 line diff
--- a/fastx_trimmer.xml Tue Oct 13 12:42:13 2015 -0400 +++ b/fastx_trimmer.xml Tue May 08 12:53:09 2018 -0400 @@ -1,30 +1,23 @@ -<tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences"> +<tool id="cshl_fastx_trimmer" version="1.0.1" name="Trim sequences"> <description></description> - <requirements> - <requirement type="package" version="0.0.13">fastx_toolkit</requirement> - </requirements> - <command> -<![CDATA[ -zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output' -#if $input.ext == "fastqsanger": - -Q 33 -#end if -]]> - </command> - + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <command detect_errors="exit_code"><![CDATA[ +@CATS@ fastx_trimmer -v +-f $first +-l $last +-o '$output' +@FQQUAL@ + ]]></command> <inputs> - <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" /> - - <param name="first" type="integer" value="1"> - <label>First base to keep</label> - </param> - - <param name="last" type="integer" value="21"> - <label>Last base to keep</label> - </param> + <expand macro="fastx_input" /> + <param name="first" type="integer" value="1" label="First base to keep" /> + <param name="last" type="integer" value="21" label="Last base to keep" /> </inputs> <outputs> - <data format_source="input" name="output" metadata_source="input" /> + <data name="output" format_source="input" metadata_source="input" /> </outputs> <tests> <test> @@ -42,7 +35,7 @@ <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" /> </test> </tests> - <help> + <help><![CDATA[ **What it does** This tool trims (cut bases from) sequences in a FASTA/Q file. @@ -58,7 +51,6 @@ >2-1 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA - Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: >1-1 @@ -78,6 +70,7 @@ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - </help> + ]]></help> + <expand macro="citations" /> <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue May 08 12:53:09 2018 -0400 @@ -0,0 +1,54 @@ +<?xml version="1.0"?> +<macros> + <token name="@CATS@"> + #if $input.is_of_type('fasta.gz', 'fastqsanger.gz', 'fastqsolexa.gz', 'fastqillumina.gz'): + zcat -f '$input' | + #elif $input.is_of_type('fastqsanger.bz2', 'fastqsolexa.bz2', 'fastqillumina.bz2'): + bzcat -f '$input' | + #else: + cat '$input' | + #end if + </token> + <token name="@FQQUAL@"> + <![CDATA[ + #if $input.is_of_type('fastqsanger', 'fastqsanger.gz', 'fastqsanger.bz2'): + -Q 33 + #elif $input.is_of_type('fastqsolexa', 'fastqsolexa.gz', 'fastqsolexa.bz2', 'fastqillumina', 'fastqillumina.gz', 'fastqillumina.bz2'): + -Q 64 + #end if + ]]> + </token> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@VERSION@">fastx_toolkit</requirement> + <yield /> + </requirements> + </xml> + <token name="@VERSION@">0.0.14</token> + <token name="@SANGER@">fastqsanger,fastqsanger.gz,fastqsanger.bz2</token> + <token name="@SOLEXA@">fastqsolexa,fastqsolexa.gz,fastqsolexa.bz2</token> + <token name="@ILLUMINA@">fastqillumina,fastqillumina.gz,fastqillumina.bz2</token> + <token name="@FASTQS@">@SANGER@,@SOLEXA@,@ILLUMINA@</token> + <token name="@FASTAS@">fasta,fasta.gz</token> + <xml name="citations"> + <citations> + <citation type="bibtex"> + @UNPUBLISHED{agordon, + author = "Assaf Gordon", + title = "FASTQ/A short-reads pre-processing tools", + year = "2010", + note = "http://hannonlab.cshl.edu/fastx_toolkit/", + url = "http://hannonlab.cshl.edu/fastx_toolkit/"} + </citation> + </citations> + </xml> + <xml name="fasta_input"> + <param name="input" type="data" format="@FASTAS@" label="Input FASTA file" /> + </xml> + <xml name="fastq_input"> + <param name="input" type="data" format="@FASTQS@" label="Input FASTQ file" /> + </xml> + <xml name="fastx_input"> + <param name="input" type="data" format="@FASTAS@,@FASTQS@" label="Input file in FASTA or FASTQ format" /> + </xml> +</macros>
--- a/tool_dependencies.xml Tue Oct 13 12:42:13 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,6 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="fastx_toolkit" version="0.0.13"> - <repository changeset_revision="e76e81b3eccf" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency>
