Mercurial > repos > devteam > fastx_trimmer

comparison fastx_trimmer.xml @ 2:97f0b63ae7cf draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734
author devteam
date Tue, 13 Oct 2015 12:42:13 -0400
parents 0288c4b3a53f
children 9081fe62bd56
comparison
equal deleted inserted replaced
1:0288c4b3a53f 2:97f0b63ae7cf
1 <tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences"> 1 <tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences">
2 <description></description> 2 <description></description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="0.0.13">fastx_toolkit</requirement> 4 <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
5 </requirements> 5 </requirements>
6 <command>zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output 6 <command>
7 <![CDATA[
8 zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output'
7 #if $input.ext == "fastqsanger": 9 #if $input.ext == "fastqsanger":
8 -Q 33 10 -Q 33
9 #end if 11 #end if
10 </command> 12 ]]>
13 </command>
11 14
12 <inputs> 15 <inputs>
13 <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" /> 16 <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" />
14 17
15 <param name="first" size="4" type="integer" value="1"> 18 <param name="first" type="integer" value="1">
16 <label>First base to keep</label> 19 <label>First base to keep</label>
17 </param> 20 </param>
18 21
19 <param name="last" size="4" type="integer" value="21"> 22 <param name="last" type="integer" value="21">
20 <label>Last base to keep</label> 23 <label>Last base to keep</label>
21 </param> 24 </param>
22 </inputs> 25 </inputs>
23 26 <outputs>
24 <tests> 27 <data format_source="input" name="output" metadata_source="input" />
25 <test> 28 </outputs>
26 <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) --> 29 <tests>
27 <param name="input" value="fastx_trimmer1.fasta" /> 30 <test>
28 <param name="first" value="5"/> 31 <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) -->
29 <param name="last" value="36"/> 32 <param name="input" value="fastx_trimmer1.fasta" />
30 <output name="output" file="fastx_trimmer1.out" /> 33 <param name="first" value="5"/>
31 </test> 34 <param name="last" value="36"/>
32 <test> 35 <output name="output" ftype="fasta" file="fastx_trimmer1.out" />
33 <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) --> 36 </test>
34 <param name="input" value="fastx_trimmer2.fastq" ftype="fastqsolexa"/> 37 <test>
35 <param name="first" value="1"/> 38 <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) -->
36 <param name="last" value="27"/> 39 <param name="input" value="fastx_trimmer2.fastq" ftype="fastqsolexa"/>
37 <output name="output" file="fastx_trimmer2.out" /> 40 <param name="first" value="1"/>
38 </test> 41 <param name="last" value="27"/>
39 </tests> 42 <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" />
40 43 </test>
41 <outputs> 44 </tests>
42 <data format="input" name="output" metadata_source="input" /> 45 <help>
43 </outputs>
44 <help>
45 **What it does** 46 **What it does**
46 47
47 This tool trims (cut bases from) sequences in a FASTA/Q file. 48 This tool trims (cut bases from) sequences in a FASTA/Q file.
48 49
49 -------- 50 --------
50 51
51 **Example** 52 **Example**
52 53
53 Input Fasta file (with 36 bases in each sequences):: 54 Input Fasta file (with 36 bases in each sequences)::
54 55
55 >1-1 56 >1-1
56 TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC 57 TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
57 >2-1 58 >2-1
58 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA 59 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
59 60
60 61
61 Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: 62 Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
62 63
63 >1-1 64 >1-1
64 TATGGTCAGAAACCATATGCA 65 TATGGTCAGAAACCATATGCA
69 70
70 >1-1 71 >1-1
71 TCAGA 72 TCAGA
72 >2-1 73 >2-1
73 AGGCT 74 AGGCT
74 75
75 ------ 76 ------
76 77
77 This tool is based on `FASTX-toolkit`__ by Assaf Gordon. 78 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
78 79
79 .. __: http://hannonlab.cshl.edu/fastx_toolkit/ 80 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
80 81 </help>
81 </help>
82 <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> 82 <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
83 </tool> 83 </tool>